Precursor miRNA: mmu-mir-467a-6

Precursor miRNA

Precursor Name mmu-mir-467a-6
Genomic Location chr2:10491048-10491130 (+); nearby genomic features
Clustered miRNAs mmu-mir-467b,mmu-mir-466c-1,mmu-mir-669a-5,mmu-mir-467a-3,mmu-mir-466c-2,mmu-mir-669a-6,mmu-mir-467a-4,mmu-mir-466b-4,mmu-mir-669a-7,mmu-mir-467a-5,mmu-mir-466b-5,mmu-mir-669p-1,mmu-mir-467a-6,mmu-mir-466c-3,mmu-mir-669a-8,mmu-mir-467a-7,mmu-mir-466b-6,mmu-mir-669a-9,mmu-mir-467a-8,mmu-mir-466b-7,mmu-mir-669p-2,mmu-mir-467a-9,mmu-mir-466b-2,mmu-mir-669a-10 (within 10kb in genome)
NCBI GENE ID 100124627
miRBase ID MI0014065
Precursor Sequence 
u    cc     c   a   cc  c             ua
 gugc  gugug gua gug  ug auguauaugcgug  u
 ||||  ||||| ||| |||  || |||||||||||||   a
 cacg  cacac cau cac  ac uacauauacguau  u
a    ua     a   c   ac  a             uu

Mature miRNA

Mature Name mmu-miR-467a-5p
Previous Name mmu-miR-467*;mmu-miR-467a
Mature Sequence 5' - uaagugccugcauguauaugcg - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0003409
Similar miRNAs mmu-miR-290a-3p, mmu-miR-292a-3p (sharing the same seed sequence with mmu-miR-467a-5p).

Mature miRNA

Mature Name mmu-miR-467a-3p
Previous Name mmu-miR-467;mmu-miR-467a;mmu-miR-467a*;mmu-miR-467a-1*;mmu-miR-467a*
Mature Sequence 5' - cauauacauacacacaccuaca - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0002108
Similar miRNAs mmu-miR-669b-3p, mmu-miR-669f-3p (sharing the same seed sequence with mmu-miR-467a-3p).

References

  • miR-26a and miR-384-5p are required for LTP maintenance and spine enlargement. Gu QH, Yu D, Hu Z, Liu X, Yang Y, Luo Y, Zhu J, Li Z. Nat Commun. 2015 Apr 10;6:6789.

  • Identifying microRNAs involved in degeneration of the organ of corti during age-related hearing loss. Zhang Q, Liu H, McGee J, Walsh EJ, Soukup GA, He DZ. PLoS One. 2013 Apr 30;8(4):e62786.

  • Profiling of T helper cell-derived small RNAs reveals unique antisense transcripts and differential association of miRNAs with argonaute proteins 1 and 2. Polikepahad S, Corry DB. Nucleic Acids Res. 2013 Jan;41(2):1164-77.

  • Genome-wide impact of a recently expanded microRNA cluster in mouse. Zheng GX, Ravi A, Gould GM, Burge CB, Sharp PA. Proc Natl Acad Sci U S A. 2011 Sep 20;108(38):15804-9.

  • A high-resolution anatomical atlas of the transcriptome in the mouse embryo. Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, Magen A, Canidio E, Pagani M, Peluso I, Lin-Marq N, Koch M, Bilio M, Cantiello I, Verde R, De Masi C, Bianchi SA, Cicchini J, Perroud E, Mehmeti S, Dagand E, Schrinner S, Nürnberger A, Schmidt K, Metz K, Zwingmann C, Brieske N, Springer C, Hernandez AM, Herzog S, Grabbe F, Sieverding C, Fischer B, Schrader K, Brockmeyer M, Dettmer S, Helbig C, Alunni V, Battaini MA, Mura C, Henrichsen CN, Garcia-Lopez R, Echevarria D, Puelles E, Garcia-Calero E, Kruse S, Uhr M, Kauck C, Feng G, Milyaev N, Ong CK, Kumar L, Lam M, Semple CA, Gyenesei A, Mundlos S, Radelof U, Lehrach H, Sarmientos P, Reymond A, Davidson DR, Dollé P, Antonarakis SE, Yaspo ML, Martinez S, Baldock RA, Eichele G, Ballabio A. PLoS Biol. 2011 Jan 18;9(1):e1000582.

  • miRNA 34a, 100, and 137 modulate differentiation of mouse embryonic stem cells. Tarantino C, Paolella G, Cozzuto L, Minopoli G, Pastore L, Parisi S, Russo T. FASEB J. 2010 Sep;24(9):3255-63.

  • Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP. Genes Dev. 2010 May 15;24(10):992-1009.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.