Precursor miRNA: mmu-mir-295

Precursor miRNA

Precursor Name mmu-mir-295
Genomic Location chr7:3220773-3220841 (+); nearby genomic features
Clustered miRNAs mmu-mir-290a,mmu-mir-290b,mmu-mir-291a,mmu-mir-292a,mmu-mir-292b,mmu-mir-291b,mmu-mir-293,mmu-mir-294,mmu-mir-295 (within 10kb in genome)
NCBI GENE ID 100049713
miRBase ID MI0000393
Precursor Sequence 
  u          u    -     ac     gac
gg gagacucaaa gugg ggcac  uucug   u
|| |||||||||| |||| |||||  |||||    g
cc cucugaguuu cauc ucgug  aagau   u
  u          u    a     -a     aca

Mature miRNA

Mature Name mmu-miR-295-3p
Previous Name mmu-miR-295
Mature Sequence 5' - aaagugcuacuacuuuugagucu - 3' (length = 23)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000373
Similar miRNAs mmu-miR-291a-3p, mmu-miR-294-3p, mmu-miR-302a-3p, mmu-miR-302b-3p, mmu-miR-302d-3p (sharing the same seed sequence with mmu-miR-295-3p).

References

  • Gadd45a opens up the promoter regions of miR-295 facilitating pluripotency induction. Li L, Chen K, Wu Y, Long Q, Zhao D, Ma B, Pei D, Liu X. Cell Death Dis. 2017 Oct 12;8(10):e3107.

  • The eutheria-specific miR-290 cluster modulates placental growth and maternal-fetal transport. Paikari A, D Belair C, Saw D, Blelloch R. Development. 2017 Oct 15;144(20):3731-3743.

  • MicroRNAs control the apoptotic threshold in primed pluripotent stem cells through regulation of BIM. Pernaute B, Spruce T, Smith KM, Sánchez-Nieto JM, Manzanares M, Cobb B, Rodríguez TA. Genes Dev. 2014 Sep 1;28(17):1873-8.

  • Two miRNA clusters reveal alternative paths in late-stage reprogramming. Parchem RJ, Ye J, Judson RL, LaRussa MF, Krishnakumar R, Blelloch A, Oldham MC, Blelloch R. Cell Stem Cell. 2014 May 1;14(5):617-31.

  • Identification of an imprinted gene cluster in the X-inactivation center. Kobayashi S, Totoki Y, Soma M, Matsumoto K, Fujihara Y, Toyoda A, Sakaki Y, Okabe M, Ishino F. PLoS One. 2013 Aug 6;8(8):e71222.

  • Trim71 cooperates with microRNAs to repress Cdkn1a expression and promote embryonic stem cell proliferation. Chang HM, Martinez NJ, Thornton JE, Hagan JP, Nguyen KD, Gregory RI. Nat Commun. 2012 Jun 26;3:923.

  • Genome-wide impact of a recently expanded microRNA cluster in mouse. Zheng GX, Ravi A, Gould GM, Burge CB, Sharp PA. Proc Natl Acad Sci U S A. 2011 Sep 20;108(38):15804-9.

  • Mir-290-295 deficiency in mice results in partially penetrant embryonic lethality and germ cell defects. Medeiros LA, Dennis LM, Gill ME, Houbaviy H, Markoulaki S, Fu D, White AC, Kirak O, Sharp PA, Page DC, Jaenisch R. Proc Natl Acad Sci U S A. 2011 Aug 23;108(34):14163-8.

  • A latent pro-survival function for the mir-290-295 cluster in mouse embryonic stem cells. Zheng GX, Ravi A, Calabrese JM, Medeiros LA, Kirak O, Dennis LM, Jaenisch R, Burge CB, Sharp PA. PLoS Genet. 2011 May;7(5):e1002054.

  • A high-resolution anatomical atlas of the transcriptome in the mouse embryo. Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, Magen A, Canidio E, Pagani M, Peluso I, Lin-Marq N, Koch M, Bilio M, Cantiello I, Verde R, De Masi C, Bianchi SA, Cicchini J, Perroud E, Mehmeti S, Dagand E, Schrinner S, Nürnberger A, Schmidt K, Metz K, Zwingmann C, Brieske N, Springer C, Hernandez AM, Herzog S, Grabbe F, Sieverding C, Fischer B, Schrader K, Brockmeyer M, Dettmer S, Helbig C, Alunni V, Battaini MA, Mura C, Henrichsen CN, Garcia-Lopez R, Echevarria D, Puelles E, Garcia-Calero E, Kruse S, Uhr M, Kauck C, Feng G, Milyaev N, Ong CK, Kumar L, Lam M, Semple CA, Gyenesei A, Mundlos S, Radelof U, Lehrach H, Sarmientos P, Reymond A, Davidson DR, Dollé P, Antonarakis SE, Yaspo ML, Martinez S, Baldock RA, Eichele G, Ballabio A. PLoS Biol. 2011 Jan 18;9(1):e1000582.

  • miRBase: integrating microRNA annotation and deep-sequencing data. Kozomara A, Griffiths-Jones S. Nucleic Acids Res. 2011 Jan;39(Database issue):D152-7.

  • An early developmental role for miRNAs in the maintenance of extraembryonic stem cells in the mouse embryo. Spruce T, Pernaute B, Di-Gregorio A, Cobb BS, Merkenschlager M, Manzanares M, Rodriguez TA. Dev Cell. 2010 Aug 17;19(2):207-19.

  • miRNA 34a, 100, and 137 modulate differentiation of mouse embryonic stem cells. Tarantino C, Paolella G, Cozzuto L, Minopoli G, Pastore L, Parisi S, Russo T. FASEB J. 2010 Sep;24(9):3255-63.

  • Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP. Genes Dev. 2010 May 15;24(10):992-1009.

  • MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A. Mol Hum Reprod. 2010 Jul;16(7):463-71.

  • Opposing microRNA families regulate self-renewal in mouse embryonic stem cells. Melton C, Judson RL, Blelloch R. Nature. 2010 Feb 4;463(7281):621-6.

  • Obesity and genetics regulate microRNAs in islets, liver, and adipose of diabetic mice. Zhao E, Keller MP, Rabaglia ME, Oler AT, Stapleton DS, Schueler KL, Neto EC, Moon JY, Wang P, Wang IM, Lum PY, Ivanovska I, Cleary M, Greenawalt D, Tsang J, Choi YJ, Kleinhanz R, Shang J, Zhou YP, Howard AD, Zhang BB, Kendziorski C, Thornberry NA, Yandell BS, Schadt EE, Attie AD. Mamm Genome. 2009 Aug;20(8):476-85.

  • Embryonic stem cell-specific microRNAs promote induced pluripotency. Judson RL, Babiarz JE, Venere M, Blelloch R. Nat Biotechnol. 2009 May;27(5):459-61.

  • Embryonic stem cell-specific microRNAs regulate the G1-S transition and promote rapid proliferation. Wang Y, Baskerville S, Shenoy A, Babiarz JE, Baehner L, Blelloch R. Nat Genet. 2008 Dec;40(12):1478-83.

  • Determination of microRNAs in mouse preimplantation embryos by microarray. Yang Y, Bai W, Zhang L, Yin G, Wang X, Wang J, Zhao H, Han Y, Yao YQ. Dev Dyn. 2008 Sep;237(9):2315-27.

    • There are 24 references associated with mmu-mir-295. Click here to see the complete list in PubMed.