Precursor miRNA: mmu-mir-363

Precursor miRNA

Precursor Name mmu-mir-363
Genomic Location chrX:52741693-52741767 (-); nearby genomic features
Clustered miRNAs mmu-mir-363,mmu-mir-92a-2,mmu-mir-19b-2,mmu-mir-20b,mmu-mir-18b,mmu-mir-106a (within 10kb in genome)
NCBI GENE ID 723852
miRBase ID MI0000765
Precursor Sequence 
u   au        -  a  a         gg  ggug
 guu  caggugga ac cg ugcaauuuu  uu    u
 |||  |||||||| || || |||||||||  ||    
 caa  gucuaccu ug gc acguuaaaa  ag    a
c   au        a  -  -         gg  gaua

Mature miRNA

Mature Name mmu-miR-363-5p
Mature Sequence 5' - cagguggaacacgaugcaauuu - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0017076

Mature miRNA

Mature Name mmu-miR-363-3p
Previous Name mmu-miR-363
Mature Sequence 5' - aauugcacgguauccaucugua - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000708
Similar miRNAs mmu-miR-25-3p, mmu-miR-32-5p, mmu-miR-367-3p, mmu-miR-92a-3p, mmu-miR-92b-3p (sharing the same seed sequence with mmu-miR-363-3p).

References

  • MicroRNA-363-3p/sphingosine-1-phosphate receptor 1 axis inhibits sepsis-induced acute lung injury via the inactivation of nuclear factor kappa-B ligand signaling. Meng S, Kang K, Fei D, Yang S, Pan S, Yu K, Zhao M. Exp Anim. 2022 Aug 5;71(3):305-315.

  • Involvement of the miR-363-5p/P2RX4 Axis in Regulating Schwann Cell Phenotype after Nerve Injury. Sohn EJ, Nam YK, Park HT. Int J Mol Sci. 2021 Oct 27;22(21):11601.

  • microRNA-363-3p reduces endothelial cell inflammatory responses in coronary heart disease via inactivation of the Zhou T, Li S, Yang L, Xiang D. Aging (Albany NY). 2021 Mar 19;13(8):11061-11082.

  • miR-17-92 and miR-106b-25 clusters regulate beta cell mitotic checkpoint and insulin secretion in mice. Mandelbaum AD, Kredo-Russo S, Aronowitz D, Myers N, Yanowski E, Klochendler A, Swisa A, Dor Y, Hornstein E. Diabetologia. 2019 Sep;62(9):1653-1666.

  • microRNA cluster 106a~363 is involved in T helper 17 cell differentiation. Kästle M, Bartel S, Geillinger-Kästle K, Irmler M, Beckers J, Ryffel B, Eickelberg O, Krauss-Etschmann S. Immunology. 2017 Nov;152(3):402-413.

  • MiR-363-3p inhibits the epithelial-to-mesenchymal transition and suppresses metastasis in colorectal cancer by targeting Sox4. Hu F, Min J, Cao X, Liu L, Ge Z, Hu J, Li X. Biochem Biophys Res Commun. 2016 May 20;474(1):35-42.

  • miR-363-5p regulates endothelial cell properties and their communication with hematopoietic precursor cells. Costa A, Afonso J, Osório C, Gomes AL, Caiado F, Valente J, Aguiar SI, Pinto F, Ramirez M, Dias S. J Hematol Oncol. 2013 Nov 21;6(1):87.

  • Distinct roles of microRNAs in epithelium and mesenchyme during tooth development. Oommen S, Otsuka-Tanaka Y, Imam N, Kawasaki M, Kawasaki K, Jalani-Ghazani F, Anderegg A, Awatramani R, Hindges R, Sharpe PT, Ohazama A. Dev Dyn. 2012 Sep;241(9):1465-72.

  • A resource of vectors and ES cells for targeted deletion of microRNAs in mice. Prosser HM, Koike-Yusa H, Cooper JD, Law FC, Bradley A. Nat Biotechnol. 2011 Aug 7;29(9):840-5.

  • Effect of Xpcl1 activation and p27(Kip1) loss on gene expression in murine lymphoma. Kuppers DA, Hwang HC, Jackson AL, Linsley PS, Clurman BE, Fero ML. PLoS One. 2011 Mar 11;6(3):e14758.

  • A high-resolution anatomical atlas of the transcriptome in the mouse embryo. Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, Magen A, Canidio E, Pagani M, Peluso I, Lin-Marq N, Koch M, Bilio M, Cantiello I, Verde R, De Masi C, Bianchi SA, Cicchini J, Perroud E, Mehmeti S, Dagand E, Schrinner S, Nürnberger A, Schmidt K, Metz K, Zwingmann C, Brieske N, Springer C, Hernandez AM, Herzog S, Grabbe F, Sieverding C, Fischer B, Schrader K, Brockmeyer M, Dettmer S, Helbig C, Alunni V, Battaini MA, Mura C, Henrichsen CN, Garcia-Lopez R, Echevarria D, Puelles E, Garcia-Calero E, Kruse S, Uhr M, Kauck C, Feng G, Milyaev N, Ong CK, Kumar L, Lam M, Semple CA, Gyenesei A, Mundlos S, Radelof U, Lehrach H, Sarmientos P, Reymond A, Davidson DR, Dollé P, Antonarakis SE, Yaspo ML, Martinez S, Baldock RA, Eichele G, Ballabio A. PLoS Biol. 2011 Jan 18;9(1):e1000582.

  • The microRNA-processing enzyme Dicer is dispensable for somite segmentation but essential for limb bud positioning. Zhang Z, O'Rourke JR, McManus MT, Lewandoski M, Harfe BD, Sun X. Dev Biol. 2011 Mar 15;351(2):254-65.

  • miRBase: integrating microRNA annotation and deep-sequencing data. Kozomara A, Griffiths-Jones S. Nucleic Acids Res. 2011 Jan;39(Database issue):D152-7.

  • Combination of in silico and in situ hybridisation approaches to identify potential Dll1 associated miRNAs during mouse embryogenesis. Hoesel B, Bhujabal Z, Przemeck GK, Kurz-Drexler A, Weisenhorn DM, Angelis MH, Beckers J. Gene Expr Patterns. 2010 Sep;10(6):265-73.

  • miRNA 34a, 100, and 137 modulate differentiation of mouse embryonic stem cells. Tarantino C, Paolella G, Cozzuto L, Minopoli G, Pastore L, Parisi S, Russo T. FASEB J. 2010 Sep;24(9):3255-63.

  • Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP. Genes Dev. 2010 May 15;24(10):992-1009.

  • MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A. Mol Hum Reprod. 2010 Jul;16(7):463-71.

  • Targeted deletion reveals essential and overlapping functions of the miR-17 through 92 family of miRNA clusters. Ventura A, Young AG, Winslow MM, Lintault L, Meissner A, Erkeland SJ, Newman J, Bronson RT, Crowley D, Stone JR, Jaenisch R, Sharp PA, Jacks T. Cell. 2008 Mar 7;132(5):875-86.

  • Transgenic over-expression of the microRNA miR-17-92 cluster promotes proliferation and inhibits differentiation of lung epithelial progenitor cells. Lu Y, Thomson JM, Wong HY, Hammond SM, Hogan BL. Dev Biol. 2007 Oct 15;310(2):442-53.

  • A mammalian microRNA expression atlas based on small RNA library sequencing. Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foà R, Schliwka J, Fuchs U, Novosel A, Müller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Weir DB, Choksi R, De Vita G, Frezzetti D, Trompeter HI, Hornung V, Teng G, Hartmann G, Palkovits M, Di Lauro R, Wernet P, Macino G, Rogler CE, Nagle JW, Ju J, Papavasiliou FN, Benzing T, Lichter P, Tam W, Brownstein MJ, Bosio A, Borkhardt A, Russo JJ, Sander C, Zavolan M, Tuschl T. Cell. 2007 Jun 29;129(7):1401-14.

    • There are 22 references associated with mmu-mir-363. Click here to see the complete list in PubMed.