Mature miRNA: mmu-miR-367-3p

Mature miRNA

miRNA Name mmu-miR-367-3p
Previous Name mmu-miR-367
miRNA Sequence 5' - aauugcacuuuagcaaugguga - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0003181
Similar miRNAs mmu-miR-25-3p, mmu-miR-32-5p, mmu-miR-363-3p, mmu-miR-92a-3p, mmu-miR-92b-3p (sharing the same seed sequence with mmu-miR-367-3p).

Precursor miRNA

Precursor Name mmu-mir-367
Genomic Location chr3:127545733-127545807 (+); nearby genomic features
Clustered miRNAs mmu-mir-302b,mmu-mir-302c,mmu-mir-302a,mmu-mir-302d,mmu-mir-367 (within 10kb in genome)
NCBI GENE ID 723911
miRBase ID MI0003531
Precursor Sequence 
   -                ca     c    uugaa
agg ccgucacuguugcuaa  ugcaa ucug     u
||| ||||||||||||||||  ||||| ||||     
ucc gguagugguaacgauu  acguu aggu     a
   a                uc     a    uaaag

References

  • Mesenchymal stem cell-derived exosomal microRNA-367-3p alleviates experimental autoimmune encephalomyelitis via inhibition of microglial ferroptosis by targeting EZH2. Fan J, Han Y, Sun H, Sun S, Wang Y, Guo R, Guo J, Tian X, Wang J, Wang J. Biomed Pharmacother. 2023 Jun;162:114593.

  • LARP7 Protects Against Heart Failure by Enhancing Mitochondrial Biogenesis. Yu H, Zhang F, Yan P, Zhang S, Lou Y, Geng Z, Li Z, Zhang Y, Xu Y, Lu Y, Chen C, Wang D, Zhu W, Hu X, Wang J, Zhuang T, Zhang Y, Wu G, Liu J, Zeng C, Pu WT, Sun K, Zhang B. Circulation. 2021 May 18;143(20):2007-2022.

  • MicroRNA-302/367 Cluster Impacts Host Antimicrobial Defense via Regulation of Mitophagic Response Against Huang T, Pu Q, Zhou C, Lin P, Gao P, Zhang X, Chu Y, Yue B, Wu M. Front Immunol. 2020 Oct 7;11:569173.

  • microRNA-367-3p regulation of GPRC5A is suppressed in ischemic stroke. Tabet F, Lee S, Zhu W, Levin MG, Toth CL, Cuesta Torres LF, Vinh A, Kim HA, Chu HX, Evans MA, Kuzmich ME, Drummond GR, Remaley AT, Rye KA, Sobey CG, Vickers KC. J Cereb Blood Flow Metab. 2020 Jun;40(6):1300-1315.

  • Enhanced neurogenesis in degenerated hippocampi following pretreatment with miR-302/367 expressing lentiviral vector in mice. Ghasemi-Kasman M, Baharvand H, Javan M. Biomed Pharmacother. 2017 Dec;96:1222-1229.

  • MiR-302/367 regulate neural progenitor proliferation, differentiation timing, and survival in neurulation. Yang SL, Yang M, Herrlinger S, Liang C, Lai F, Chen JF. Dev Biol. 2015 Dec 1;408(1):140-50.

  • miR-302 Is Required for Timing of Neural Differentiation, Neural Tube Closure, and Embryonic Viability. Parchem RJ, Moore N, Fish JL, Parchem JG, Braga TT, Shenoy A, Oldham MC, Rubenstein JL, Schneider RA, Blelloch R. Cell Rep. 2015 Aug 4;12(5):760-73.

  • Deregulation of MiR-34b/Sox2 Predicts Prostate Cancer Progression. Forno I, Ferrero S, Russo MV, Gazzano G, Giangiobbe S, Montanari E, Del Nero A, Rocco B, Albo G, Languino LR, Altieri DC, Vaira V, Bosari S. PLoS One. 2015 Jun 24;10(6):e0130060.

  • miR-367 promotes epithelial-to-mesenchymal transition and invasion of pancreatic ductal adenocarcinoma cells by targeting the Smad7-TGF-β signalling pathway. Zhu Z, Xu Y, Zhao J, Liu Q, Feng W, Fan J, Wang P. Br J Cancer. 2015 Apr 14;112(8):1367-75.

  • A microRNA-Hippo pathway that promotes cardiomyocyte proliferation and cardiac regeneration in mice. Tian Y, Liu Y, Wang T, Zhou N, Kong J, Chen L, Snitow M, Morley M, Li D, Petrenko N, Zhou S, Lu M, Gao E, Koch WJ, Stewart KM, Morrisey EE. Sci Transl Med. 2015 Mar 18;7(279):279ra38.

  • MicroRNAs control the apoptotic threshold in primed pluripotent stem cells through regulation of BIM. Pernaute B, Spruce T, Smith KM, Sánchez-Nieto JM, Manzanares M, Cobb B, Rodríguez TA. Genes Dev. 2014 Sep 1;28(17):1873-8.

  • Regulation of lung endoderm progenitor cell behavior by miR302/367. Tian Y, Zhang Y, Hurd L, Hannenhalli S, Liu F, Lu MM, Morrisey EE. Development. 2011 Apr;138(7):1235-45.

  • A high-resolution anatomical atlas of the transcriptome in the mouse embryo. Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, Magen A, Canidio E, Pagani M, Peluso I, Lin-Marq N, Koch M, Bilio M, Cantiello I, Verde R, De Masi C, Bianchi SA, Cicchini J, Perroud E, Mehmeti S, Dagand E, Schrinner S, Nürnberger A, Schmidt K, Metz K, Zwingmann C, Brieske N, Springer C, Hernandez AM, Herzog S, Grabbe F, Sieverding C, Fischer B, Schrader K, Brockmeyer M, Dettmer S, Helbig C, Alunni V, Battaini MA, Mura C, Henrichsen CN, Garcia-Lopez R, Echevarria D, Puelles E, Garcia-Calero E, Kruse S, Uhr M, Kauck C, Feng G, Milyaev N, Ong CK, Kumar L, Lam M, Semple CA, Gyenesei A, Mundlos S, Radelof U, Lehrach H, Sarmientos P, Reymond A, Davidson DR, Dollé P, Antonarakis SE, Yaspo ML, Martinez S, Baldock RA, Eichele G, Ballabio A. PLoS Biol. 2011 Jan 18;9(1):e1000582.

  • miRBase: integrating microRNA annotation and deep-sequencing data. Kozomara A, Griffiths-Jones S. Nucleic Acids Res. 2011 Jan;39(Database issue):D152-7.

  • miRNA 34a, 100, and 137 modulate differentiation of mouse embryonic stem cells. Tarantino C, Paolella G, Cozzuto L, Minopoli G, Pastore L, Parisi S, Russo T. FASEB J. 2010 Sep;24(9):3255-63.

  • Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP. Genes Dev. 2010 May 15;24(10):992-1009.

  • MicroRNA profiling of developing and regenerating pancreas reveal post-transcriptional regulation of neurogenin3. Joglekar MV, Parekh VS, Mehta S, Bhonde RR, Hardikar AA. Dev Biol. 2007 Nov 15;311(2):603-12.

  • A mammalian microRNA expression atlas based on small RNA library sequencing. Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foà R, Schliwka J, Fuchs U, Novosel A, Müller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Weir DB, Choksi R, De Vita G, Frezzetti D, Trompeter HI, Hornung V, Teng G, Hartmann G, Palkovits M, Di Lauro R, Wernet P, Macino G, Rogler CE, Nagle JW, Ju J, Papavasiliou FN, Benzing T, Lichter P, Tam W, Brownstein MJ, Bosio A, Borkhardt A, Russo JJ, Sander C, Zavolan M, Tuschl T. Cell. 2007 Jun 29;129(7):1401-14.

  • The expression profile of microRNAs in mouse embryos. Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I. Nucleic Acids Res. 2006 Mar 31;34(6):1765-71.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.

    • There are 21 references associated with mmu-miR-367-3p. Click here to see the complete list in PubMed.