Precursor miRNA: mmu-mir-302b

Precursor miRNA

Precursor Name mmu-mir-302b
Genomic Location chr3:127545228-127545301 (+); nearby genomic features
Clustered miRNAs mmu-mir-302b,mmu-mir-302c,mmu-mir-302a,mmu-mir-302d,mmu-mir-367 (within 10kb in genome)
NCBI GENE ID 723948
miRBase ID MI0003716
Precursor Sequence 
guucc    a   uu         au    ucugu   au
     cuuc acu  aacauggga  gcuu     cuc  c
     |||| |||  |||||||||  ||||     |||  
     gaag uga  uuguaccuu  ugaa     gag  g
----u    a   uu         cg    ----u   aa

Mature miRNA

Mature Name mmu-miR-302b-3p
Previous Name mmu-miR-302b
Mature Sequence 5' - uaagugcuuccauguuuuaguag - 3' (length = 23)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0003374
Similar miRNAs mmu-miR-291a-3p, mmu-miR-294-3p, mmu-miR-295-3p, mmu-miR-302a-3p, mmu-miR-302d-3p (sharing the same seed sequence with mmu-miR-302b-3p).

References

  • Post-transcriptional regulation in cranial neural crest cells expands developmental potential. Keuls RA, Oh YS, Patel I, Parchem RJ. Proc Natl Acad Sci U S A. 2023 Feb 7;120(6):e2212578120.

  • LARP7 Protects Against Heart Failure by Enhancing Mitochondrial Biogenesis. Yu H, Zhang F, Yan P, Zhang S, Lou Y, Geng Z, Li Z, Zhang Y, Xu Y, Lu Y, Chen C, Wang D, Zhu W, Hu X, Wang J, Zhuang T, Zhang Y, Wu G, Liu J, Zeng C, Pu WT, Sun K, Zhang B. Circulation. 2021 May 18;143(20):2007-2022.

  • Downregulation of microRNA-302b-3p relieves oxygen-glucose deprivation/re-oxygenation induced injury in murine hippocampal neurons through up-regulating Nrf2 signaling by targeting fibroblast growth factor 15/19. Zhang Z, Wang N, Zhang Y, Zhao J, Lv J. Chem Biol Interact. 2019 Aug 25;309:108705.

  • miRNA expression profiling uncovers a role of miR-302b-3p in regulating skin fibroblasts senescence. Tan J, Hu L, Yang X, Zhang X, Wei C, Lu Q, Chen Z, Li J. J Cell Biochem. 2020 Jan;121(1):70-80.

  • MiR-302/367 regulate neural progenitor proliferation, differentiation timing, and survival in neurulation. Yang SL, Yang M, Herrlinger S, Liang C, Lai F, Chen JF. Dev Biol. 2015 Dec 1;408(1):140-50.

  • miR-302 Is Required for Timing of Neural Differentiation, Neural Tube Closure, and Embryonic Viability. Parchem RJ, Moore N, Fish JL, Parchem JG, Braga TT, Shenoy A, Oldham MC, Rubenstein JL, Schneider RA, Blelloch R. Cell Rep. 2015 Aug 4;12(5):760-73.

  • A microRNA-Hippo pathway that promotes cardiomyocyte proliferation and cardiac regeneration in mice. Tian Y, Liu Y, Wang T, Zhou N, Kong J, Chen L, Snitow M, Morley M, Li D, Petrenko N, Zhou S, Lu M, Gao E, Koch WJ, Stewart KM, Morrisey EE. Sci Transl Med. 2015 Mar 18;7(279):279ra38.

  • MicroRNA-302b augments host defense to bacteria by regulating inflammatory responses via feedback to TLR/IRAK4 circuits. Zhou X, Li X, Ye Y, Zhao K, Zhuang Y, Li Y, Wei Y, Wu M. Nat Commun. 2014 Apr 10;5:3619.

  • Genome-wide microRNA and messenger RNA profiling in rodent liver development implicates mir302b and mir20a in repressing transforming growth factor-beta signaling. Wei W, Hou J, Alder O, Ye X, Lee S, Cullum R, Chu A, Zhao Y, Warner SM, Knight DA, Yang D, Jones SJ, Marra MA, Hoodless PA. Hepatology. 2013 Jun;57(6):2491-501.

  • Trim71 cooperates with microRNAs to repress Cdkn1a expression and promote embryonic stem cell proliferation. Chang HM, Martinez NJ, Thornton JE, Hagan JP, Nguyen KD, Gregory RI. Nat Commun. 2012 Jun 26;3:923.

  • A resource of vectors and ES cells for targeted deletion of microRNAs in mice. Prosser HM, Koike-Yusa H, Cooper JD, Law FC, Bradley A. Nat Biotechnol. 2011 Aug 7;29(9):840-5.

  • Regulation of lung endoderm progenitor cell behavior by miR302/367. Tian Y, Zhang Y, Hurd L, Hannenhalli S, Liu F, Lu MM, Morrisey EE. Development. 2011 Apr;138(7):1235-45.

  • A high-resolution anatomical atlas of the transcriptome in the mouse embryo. Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, Magen A, Canidio E, Pagani M, Peluso I, Lin-Marq N, Koch M, Bilio M, Cantiello I, Verde R, De Masi C, Bianchi SA, Cicchini J, Perroud E, Mehmeti S, Dagand E, Schrinner S, Nürnberger A, Schmidt K, Metz K, Zwingmann C, Brieske N, Springer C, Hernandez AM, Herzog S, Grabbe F, Sieverding C, Fischer B, Schrader K, Brockmeyer M, Dettmer S, Helbig C, Alunni V, Battaini MA, Mura C, Henrichsen CN, Garcia-Lopez R, Echevarria D, Puelles E, Garcia-Calero E, Kruse S, Uhr M, Kauck C, Feng G, Milyaev N, Ong CK, Kumar L, Lam M, Semple CA, Gyenesei A, Mundlos S, Radelof U, Lehrach H, Sarmientos P, Reymond A, Davidson DR, Dollé P, Antonarakis SE, Yaspo ML, Martinez S, Baldock RA, Eichele G, Ballabio A. PLoS Biol. 2011 Jan 18;9(1):e1000582.

  • miRBase: integrating microRNA annotation and deep-sequencing data. Kozomara A, Griffiths-Jones S. Nucleic Acids Res. 2011 Jan;39(Database issue):D152-7.

  • miRNA 34a, 100, and 137 modulate differentiation of mouse embryonic stem cells. Tarantino C, Paolella G, Cozzuto L, Minopoli G, Pastore L, Parisi S, Russo T. FASEB J. 2010 Sep;24(9):3255-63.

  • Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP. Genes Dev. 2010 May 15;24(10):992-1009.

  • MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A. Mol Hum Reprod. 2010 Jul;16(7):463-71.

  • Oct4/Sox2-regulated miR-302 targets cyclin D1 in human embryonic stem cells. Card DA, Hebbar PB, Li L, Trotter KW, Komatsu Y, Mishina Y, Archer TK. Mol Cell Biol. 2008 Oct;28(20):6426-38.

  • A mammalian microRNA expression atlas based on small RNA library sequencing. Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foà R, Schliwka J, Fuchs U, Novosel A, Müller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Weir DB, Choksi R, De Vita G, Frezzetti D, Trompeter HI, Hornung V, Teng G, Hartmann G, Palkovits M, Di Lauro R, Wernet P, Macino G, Rogler CE, Nagle JW, Ju J, Papavasiliou FN, Benzing T, Lichter P, Tam W, Brownstein MJ, Bosio A, Borkhardt A, Russo JJ, Sander C, Zavolan M, Tuschl T. Cell. 2007 Jun 29;129(7):1401-14.

  • The expression profile of microRNAs in mouse embryos. Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I. Nucleic Acids Res. 2006 Mar 31;34(6):1765-71.

    • There are 21 references associated with mmu-mir-302b. Click here to see the complete list in PubMed.