Precursor miRNA: mmu-mir-183

Precursor miRNA

Precursor Name mmu-mir-183
Genomic Location chr6:30169668-30169737 (-); nearby genomic features
Clustered miRNAs mmu-mir-182,mmu-mir-96,mmu-mir-183 (within 10kb in genome)
NCBI GENE ID 387178
miRBase ID MI0000225
Precursor Sequence 
    g      --ac     ga        --   ac
cugu uauggc    uggua  auucacug  uga  a
|||| ||||||    |||||  ||||||||  |||  
gaca auaccg    gccau  uaagugac  acu  g
    a      ggaa     --        ug   cu

Mature miRNA

Mature Name mmu-miR-183-5p
Previous Name mmu-miR-183
Mature Sequence 5' - uauggcacugguagaauucacu - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000212

References

  • The miR-183/96/182 cluster is a checkpoint for resident immune cells and shapes the cellular landscape of the cornea. Li W, Gurdziel K, Pitchaikannu A, Gupta N, Hazlett LD, Xu S. Ocul Surf. 2023 Oct;30:17-41.

  • Carnosol attenuated atrophy of C2C12 myotubes induced by tumour-derived exosomal miR-183-5p through inhibiting Smad3 pathway activation and keeping mitochondrial respiration. Kuang JX, Shen Q, Zhang RQ, Fang QY, Deng X, Fan M, Cheng CR, Zhang XW, Liu X. Basic Clin Pharmacol Toxicol. 2022 Dec;131(6):500-513.

  • MicroRNA-183-5p regulates MITF expression in vitiligo skin depigmentation. Al Robaee AA, Alzolibani AA, Rasheed Z. Nucleosides Nucleotides Nucleic Acids. 2022;41(8):703-723.

  • Phenotypic Drift in Lupus-Prone MRL/lpr Mice: Potential Roles of MicroRNAs and Gut Microbiota. Cabana-Puig X, Bond JM, Wang Z, Dai R, Lu R, Lin A, Oakes V, Rizzo A, Swartwout B, Abdelhamid L, Mao J, Prakash M, Sangmeister C, Cheung N, Cowan C, Reilly CM, Sun S, Ahmed SA, Luo XM. Immunohorizons. 2022 Jan 17;6(1):36-46.

  • Prophylactic Knockdown of the miR-183/96/182 Cluster Ameliorates Pseudomonas aeruginosa-Induced Keratitis. McClellan S, Pitchaikannu A, Wright R, Bessert D, Iulianelli M, Hazlett LD, Xu S. Invest Ophthalmol Vis Sci. 2021 Dec 1;62(15):14.

  • MiR-183 regulates the differentiation of osteoblasts in the development of osteoporosis by targeting Smad4. Qin XB, Wen K, Wu XX, Yao ZJ. Acta Histochem. 2021 Oct;123(7):151786.

  • Loss of miR-183/96 Alters Synaptic Strength via Presynaptic and Postsynaptic Mechanisms at a Central Synapse. Krohs C, Körber C, Ebbers L, Altaf F, Hollje G, Hoppe S, Dörflinger Y, Prosser HM, Nothwang HG. J Neurosci. 2021 Aug 11;41(32):6796-6811.

  • A genome-wide microRNA screen identifies the microRNA-183/96/182 cluster as a modulator of circadian rhythms. Zhou L, Miller C, Miraglia LJ, Romero A, Mure LS, Panda S, Kay SA. Proc Natl Acad Sci U S A. 2021 Jan 5;118(1):e2020454118.

  • Obesity-induced upregulation of microRNA-183-5p promotes hepatic triglyceride accumulation by targeting the B-cell translocation gene 1. Zhou X, Yuan Y, Teng F, Li K, Luo S, Zhang P, Liu D, Zhang H, Zhang J. Life Sci. 2021 Mar 1;268:119011.

  • The miR-183/96/182 Cluster Regulates the Functions of Corneal Resident Macrophages. Coku A, McClellan SA, Van Buren E, Back JB, Hazlett LD, Xu S. Immunohorizons. 2020 Nov 18;4(11):729-744.

  • MiR-183-5p induced by saturated fatty acids regulates the myogenic differentiation by directly targeting FHL1 in C2C12 myoblasts. Nguyen MT, Min KH, Lee W. BMB Rep. 2020 Nov;53(11):605-610.

  • Mouse 4T1 Breast Cancer Cell-Derived Exosomes Induce Proinflammatory Cytokine Production in Macrophages via miR-183. Guo J, Duan Z, Zhang C, Wang W, He H, Liu Y, Wu P, Wang S, Song M, Chen H, Chen C, Si Q, Xiang R, Luo Y. J Immunol. 2020 Nov 15;205(10):2916-2925.

  • miR‑183‑5p attenuates cerebral ischemia injury by negatively regulating PTEN. Zhu L, Zhou X, Li S, Liu J, Yang J, Fan X, Zhou S. Mol Med Rep. 2020 Nov;22(5):3944-3954.

  • miR-183-5p alleviates early injury after intracerebral hemorrhage by inhibiting heme oxygenase-1 expression. Wang Y, Song Y, Pang Y, Yu Z, Hua W, Gu Y, Qi J, Wu H. Aging (Albany NY). 2020 Jun 29;12(13):12869-12895.

  • MicroRNA-183-5p is stress-inducible and protects neurons against cell death in amyotrophic lateral sclerosis. Li C, Chen Y, Chen X, Wei Q, Ou R, Gu X, Cao B, Shang H. J Cell Mol Med. 2020 Aug;24(15):8614-8622.

  • miR-96 and miR-183 differentially regulate neonatal and adult postinfarct neovascularization. Castellan RF, Vitiello M, Vidmar M, Johnstone S, Iacobazzi D, Mellis D, Cathcart B, Thomson A, Ruhrberg C, Caputo M, Newby DE, Gray GA, Baker AH, Caporali A, Meloni M. JCI Insight. 2020 Jul 23;5(14):e134888.

  • MicroRNA-183 exerts a protective role in lupus nephritis through blunting the activation of TGF-β/Smad/TLR3 pathway via reducing Tgfbr1. Qi H, Cao Q, Liu Q. Exp Cell Res. 2020 Sep 15;394(2):112138.

  • Ablation of Mature miR-183 Leads to Retinal Dysfunction in Mice. Zhang CJ, Xiang L, Chen XJ, Wang XY, Wu KC, Zhang BW, Chen DF, Jin GH, Zhang H, Chen YC, Liu WQ, Li ML, Ma Y, Jin ZB. Invest Ophthalmol Vis Sci. 2020 Mar 9;61(3):12.

  • Combined microRNA and mRNA detection in mammalian retinas by in situ hybridization chain reaction. Zhuang P, Zhang H, Welchko RM, Thompson RC, Xu S, Turner DL. Sci Rep. 2020 Jan 15;10(1):351.

  • miR-183-96-182 Cluster Is Involved in Invariant NKT Cell Development, Maturation, and Effector Function. Wang J, Li G, Wu X, Liu Q, Yin C, Brown SL, Xu S, Mi QS, Zhou L. J Immunol. 2019 Dec 15;203(12):3256-3267.

    • There are 77 references associated with mmu-mir-183. Click here to see the complete list in PubMed.