Precursor miRNA: mmu-mir-182

Precursor miRNA

Precursor Name mmu-mir-182
Genomic Location chr6:30165918-30165992 (-); nearby genomic features
Clustered miRNAs mmu-mir-182,mmu-mir-96,mmu-mir-183 (within 10kb in genome)
NCBI GENE ID 387177
miRBase ID MI0000224
Precursor Sequence 
     uu       u -g      uca      uaaggu
accau  uuggcaa g  uagaac   caccgg      a
|||||  ||||||| |  ||||||   ||||||      
uggua  aaccguu c  aucuug   guggcc      a
     uc       - ag      ---      cagggu

Mature miRNA

Mature Name mmu-miR-182-5p
Previous Name mmu-miR-182
Mature Sequence 5' - uuuggcaaugguagaacucacaccg - 3' (length = 25)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000211

References

  • Liver microRNA transcriptome reveals miR-182 as link between type 2 diabetes and fatty liver disease in obesity. Krause C, Britsemmer JH, Bernecker M, Molenaar A, Taege N, Lopez-Alcantara N, Geißler C, Kaehler M, Iben K, Judycka A, Wagner J, Wolter S, Mann O, Pfluger P, Cascorbi I, Lehnert H, Stemmer K, Schriever SC, Kirchner H. Elife. 2024 Jul 22;12:RP92075.

  • KLF5-mediated pyroptosis of airway epithelial cells leads to airway inflammation in asthmatic mice through the miR-182-5p/TLR4 axis. Lin Z, Bao R, Niu Y, Kong X. Mol Immunol. 2024 Jun;170:9-18.

  • Low expression of miR-182 caused by DNA hypermethylation accelerates acute lymphocyte leukemia development by targeting PBX3 and BCL2: miR-182 promoter methylation is a predictive marker for hypomethylation agents + BCL2 inhibitor venetoclax. Li D, Yuan Y, Meng C, Lin Z, Zhao M, Shi L, Li M, Ye D, Cai Y, He X, Ye H, Zhou S, Zhou H, Gao S. Clin Epigenetics. 2024 Mar 26;16(1):48.

  • CircPTK2 may be associated with depressive-like behaviors by influencing miR-182-5p. Wang K, Yang Y, Wang Y, Jiang Z, Fang S. Behav Brain Res. 2024 Mar 28;462:114870.

  • The miR-183/96/182 cluster is a checkpoint for resident immune cells and shapes the cellular landscape of the cornea. Li W, Gurdziel K, Pitchaikannu A, Gupta N, Hazlett LD, Xu S. Ocul Surf. 2023 Oct;30:17-41.

  • Transcription Factor EGR1 Facilitates Neovascularization in Mice with Retinopathy of Prematurity by Regulating the miR-182-5p/EFNA5 Axis. Peng N, Zheng M, Song B, Jiao R, Wang W. Biochem Genet. 2024 Apr;62(2):1070-1086.

  • Sleep Deprivation Promotes Endothelial Inflammation and Atherogenesis by Reducing Exosomal miR-182-5p. Li X, Cao Y, Xu X, Wang C, Ni Q, Lv X, Yang C, Zhang Z, Qi X, Song G. Arterioscler Thromb Vasc Biol. 2023 Jun;43(6):995-1014.

  • DNA hypermethylation-induced miR-182 silence targets BCL2 and HOXA9 to facilitate the self-renewal of leukemia stem cell, accelerate acute myeloid leukemia progression, and determine the sensitivity of BCL2 inhibitor venetoclax. Ye S, Xiong F, He X, Yuan Y, Li D, Ye D, Shi L, Lin Z, Zhao M, Feng S, Zhou B, Weng H, Hong L, Ye H, Gao S. Theranostics. 2023 Jan 1;13(1):77-94.

  • miR-182-5p attenuates Zhao X, Xia Z, Wang Z, Zhou M, Qiu X, Wang C, Xu T, Fang Q, Ming Z, Dong H. Acta Biochim Biophys Sin (Shanghai). 2022 Sep 25;54(10):1421-1430.

  • Hypoxic bone marrow mesenchymal stromal cells-derived exosomal miR-182-5p promotes liver regeneration via FOXO1-mediated macrophage polarization. Xu J, Chen P, Yu C, Shi Q, Wei S, Li Y, Qi H, Cao Q, Guo C, Wu X, Di G. FASEB J. 2022 Oct;36(10):e22553.

  • MiR-182 Inhibition Protects Against Experimental Stroke in vivo and Mitigates Astrocyte Injury and Inflammation in vitro via Modulation of Cortactin Activity. Alhadidi QM, Xu L, Sun X, Althobaiti YS, Almalki A, Alsaab HO, Stary CM. Neurochem Res. 2022 Dec;47(12):3682-3696.

  • miR-182-5p promotes hepatocyte-stellate cell crosstalk to facilitate liver regeneration. Xiao T, Meng W, Jin Z, Wang J, Deng J, Wen J, Liu B, Liu M, Bai J, Liu F. Commun Biol. 2022 Aug 1;5(1):771.

  • Deletion of microRNA-183-96-182 Cluster in Lymphocytes Suppresses Anti-DsDNA Autoantibody Production and IgG Deposition in the Kidneys in C57BL/6-Fas Wang Z, Heid B, Lu R, Sachdeva M, Edwards MR, Ren J, Cecere TE, Khan D, Jeboda T, Kirsch DG, Reilly CM, Dai R, Ahmed SA. Front Genet. 2022 Jul 7;13:840060.

  • Adipose Rheb deficiency promotes miR-182-5p expression via the cAMP/PPARγ signaling pathway. Wen J, Deng J, Xiao T, Liu Y, Meng W. J Genet Genomics. 2023 Jan;50(1):20-26.

  • MicroRNA-182-5p aggravates ulcerative colitis by inactivating the Wnt/β-catenin signaling pathway through DNMT3A-mediated SMARCA5 methylation. Xu Y, Yang J, Chen X, Deng J, Gong H, Li F, Ouyang M. Genomics. 2022 May;114(3):110360.

  • Inhibiting miR-182-3p Alleviates Gestational Diabetes Mellitus by Improving Insulin Resistance in Skeletal Muscle. Rao J, Chen Y, Huang J, Wu R, Dong Z, Gao Y, Chen X. Balkan Med J. 2022 Mar 14;39(2):121-129.

  • miR-182 targeting reprograms tumor-associated macrophages and limits breast cancer progression. Ma C, He D, Tian P, Wang Y, He Y, Wu Q, Jia Z, Zhang X, Zhang P, Ying H, Jin ZB, Hu G. Proc Natl Acad Sci U S A. 2022 Feb 8;119(6):e2114006119.

  • Prophylactic Knockdown of the miR-183/96/182 Cluster Ameliorates Pseudomonas aeruginosa-Induced Keratitis. McClellan S, Pitchaikannu A, Wright R, Bessert D, Iulianelli M, Hazlett LD, Xu S. Invest Ophthalmol Vis Sci. 2021 Dec 1;62(15):14.

  • MiRNA-182-5p aggravates experimental ulcerative colitis via sponging Claudin-2. Tang S, Guo W, Kang L, Liang J. J Mol Histol. 2021 Dec;52(6):1215-1224.

  • The miR-182-5p/FGF21/acetylcholine axis mediates the crosstalk between adipocytes and macrophages to promote beige fat thermogenesis. Meng W, Xiao T, Liang X, Wen J, Peng X, Wang J, Zou Y, Liu J, Bialowas C, Luo H, Zhang Y, Liu B, Zhang J, Hu F, Liu M, Dong LQ, Zhou Z, Liu F, Bai J. JCI Insight. 2021 Sep 8;6(17):e150249.

    • There are 112 references associated with mmu-mir-182. Click here to see the complete list in PubMed.