Precursor miRNA: hsa-mir-495

Precursor miRNA

Precursor Name hsa-mir-495
Genomic Location chr14:101033755-101033836 (+); nearby genomic features
Clustered miRNAs hsa-mir-299,hsa-mir-380,hsa-mir-1197,hsa-mir-323a,hsa-mir-758,hsa-mir-329-1,hsa-mir-329-2,hsa-mir-494,hsa-mir-1193,hsa-mir-543,hsa-mir-495,hsa-mir-376c,hsa-mir-376a-2,hsa-mir-654,hsa-mir-376b,hsa-mir-376a-1,hsa-mir-300,hsa-mir-1185-1 (within 10kb in genome)
NCBI GENE ID 574453
MIM ID 615149
miRBase ID MI0003135
Precursor Sequence 
u      u          u  -       au     - uuu
 gguacc gaaaagaagu gc ccauguu  uuucg c   a
 |||||| |||||||||| || |||||||  ||||| |    u
 cuaugg uuuuucuuca cg gguacaa  aaagc g   a
a      c          -  u       ac     a ugu

Mature miRNA

Mature Name hsa-miR-495-3p
Previous Name hsa-miR-495
Mature Sequence 5' - aaacaaacauggugcacuucuu - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0002817
Similar miRNAs hsa-miR-5688 (sharing the same seed sequence with hsa-miR-495-3p).

References

  • Specificity protein 1/3 regulate T-cell acute lymphoblastic leukemia cell proliferation and apoptosis through β-catenin by acting as targets of miR-495-3p. Zheng B, Geng Y, Li Y, Huang H, Liu A. Ann Hematol. 2024 Aug;103(8):2945-2960.

  • MicroRNA-495: a therapeutic and diagnostic tumor marker. Maharati A, Tolue Ghasaban F, Akhlaghipour I, Taghehchian N, Zangouei AS, Moghbeli M. J Mol Histol. 2023 Dec;54(6):559-578.

  • Downregulated miR-495-3p in colorectal cancer targets TGFβR1, TGFβR2, SMAD4 and BUB1 genes and induces cell cycle arrest. Kabiri F, Medlej A, Saleh AJ, Aghdami N, Khani M, Soltani BM. Cancer Treat Res Commun. 2023;35:100702.

  • lncRNA NEAT1/miR-495-3p regulates angiogenesis in burn sepsis through the TGF-β1 and SMAD signaling pathways. Meng Y, Hao Z, Zhang H, Bai P, Guo W, Tian X, Xu J. Immun Inflamm Dis. 2023 Jan;11(1):e758.

  • CREB1 regulates KPNA2 by inhibiting mir-495-3p transcription to control melanoma progression : The role of the CREB1/miR-495-3p/KPNA2 axis in melanoma progression. Geng X, Qiu X, Gao J, Gong Z, Zhou X, Liu C, Luo H. BMC Mol Cell Biol. 2022 Dec 15;23(1):57.

  • Impact of miR-200b and miR-495 variants on the risk of large-artery atherosclerosis stroke. Qin S, Shen C, Tang W, Wang M, Lin Y, Wang Z, Li Y, Zhang Z, Liu X. Metab Brain Dis. 2023 Feb;38(2):631-639.

  • The Potential of miR-370-3p and miR-495-3p Serving as Biomarkers for Sepsis-Associated Acute Kidney Injury. Ma W, Miao X, Xia F, Ruan C, Tao D, Li B. Comput Math Methods Med. 2022 Jul 11;2022:2439509.

  • miR-495-3p regulates sphingolipid metabolic reprogramming to induce Sphk1/ceramide mediated mitophagy and apoptosis in NSCLC. Arora S, Singh P, Tabassum G, Dohare R, Syed MA. Free Radic Biol Med. 2022 Aug 20;189:71-84.

  • Circular RNA VMA21 ameliorates IL-1β-engendered chondrocyte injury through the miR-495-3p/FBWX7 signaling axis. Li Z, Meng D, Liu Y, Bi F, Tian K, Xu J, Sun J, Gu C, Li Y. Clin Immunol. 2022 May;238:108995.

  • miR-495-3p depresses cell proliferation and migration by downregulating HMGB1 in colorectal cancer. Zhang JL, Zheng HF, Li K, Zhu YP. World J Surg Oncol. 2022 Mar 30;20(1):101.

  • Long non-coding RNA MEG8 induced by PLAG1 promotes clear cell renal cell carcinoma through the miR-495-3p/G3BP1 axis. Shan G, Huang T, Tang T. Pathol Res Pract. 2022 Jan;229:153734.

  • Induction of lncRNA NORAD accounts for hypoxia-induced chemoresistance and vasculogenic mimicry in colorectal cancer by sponging the miR-495-3p/ hypoxia-inducible factor-1α (HIF-1α). Zhang L, Wu H, Zhang Y, Xiao X, Chu F, Zhang L. Bioengineered. 2022 Jan;13(1):950-962.

  • MiR-495 Inhibits Cisplatin Resistance and Angiogenesis in Esophageal Cancer by Targeting ATP7A. Li Z, Li S, Wen Y, Chen J, Liu K, Jia J. Technol Cancer Res Treat. 2021 Jan-Dec;20:15330338211039127.

  • Long non-coding RNA (lncRNA) nuclear enriched abundant transcript 1 (NEAT1) promotes the inflammation and apoptosis of otitis media with effusion through targeting microRNA (miR)-495 and activation of p38 MAPK signaling pathway. Hu Y, Dong H, Huang J, Huang J, Tao D, Huang C, Hu L, Xu H, Sun Y. Bioengineered. 2021 Dec;12(1):8080-8088.

  • Silencing circ‑BIRC6 inhibits the proliferation, invasion, migration and epithelial‑mesenchymal transition of bladder cancer cells by targeting the miR‑495‑3p/XBP1 signaling axis. Zhou L, Wang B, Zhang Y, Yao K, Liu B. Mol Med Rep. 2021 Nov;24(5):811.

  • MicroRNA miR-495 regulates the development of Hepatocellular Carcinoma by targeting C1q/tumor necrosis factor-related protein-3 (CTRP3). Zhang R, Guo C, Liu T, Li W, Chen X. Bioengineered. 2021 Dec;12(1):6902-6912.

  • Weighted genes associated with the progression of retinoblastoma: Evidence from bioinformatic analysis. Zhou W, Guan W, Zhou Y, Rao Y, Ji X, Li J. Exp Eye Res. 2021 Oct;211:108730.

  • MiR-495-3p and miR-143-3p co-target CDK1 to inhibit the development of cervical cancer. Tang J, Pan H, Wang W, Qi C, Gu C, Shang A, Zhu J. Clin Transl Oncol. 2021 Nov;23(11):2323-2334.

  • SUMOylation of IGF2BP2 promotes vasculogenic mimicry of glioma via regulating OIP5-AS1/miR-495-3p axis. Li H, Wang D, Yi B, Cai H, Wang Y, Lou X, Xi Z, Li Z. Int J Biol Sci. 2021 Jul 13;17(11):2912-2930.

  • MicroRNA-495/TGF-β/FOXC1 axis regulates multidrug resistance in metaplastic breast cancer cells. Kumar U, Hu Y, Masrour N, Castellanos-Uribe M, Harrod A, May ST, Ali S, Speirs V, Coombes RC, Yagüe E. Biochem Pharmacol. 2021 Oct;192:114692.

    • There are 108 references associated with hsa-mir-495. Click here to see the complete list in PubMed.