Precursor miRNA: hsa-mir-323a

Precursor miRNA

Precursor Name hsa-mir-323a
Genomic Location chr14:101025732-101025817 (+); nearby genomic features
Clustered miRNAs hsa-mir-379,hsa-mir-411,hsa-mir-299,hsa-mir-380,hsa-mir-1197,hsa-mir-323a,hsa-mir-758,hsa-mir-329-1,hsa-mir-329-2,hsa-mir-494,hsa-mir-1193,hsa-mir-543,hsa-mir-495 (within 10kb in genome)
NCBI GENE ID 442897
miRBase ID MI0000807
Precursor Sequence 
---uu      u g        g u     gcgc  u    uua
     gguacu g agagaggu g ccgug    gu cgcu   u
     |||||| | |||||||| | |||||    || ||||   
     cuauga c uuucucca c ggcac    ca gcgg   u
cuaau      - g        g u     auua  c    uau

Mature miRNA

Mature Name hsa-miR-323a-3p
Previous Name hsa-miR-323;hsa-miR-323-3p
Mature Sequence 5' - cacauuacacggucgaccucu - 3' (length = 21)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000755

References

  • Tumor-suppressive miR-323a inhibits pancreatic cancer cell proliferation and glycolysis through targeting HK-2. Wei Y, Wang M, Liang M, Liu L, Mo S, Zhang H, Chen Y, Li N. Pathol Int. 2022 Dec;72(12):617-630.

  • miRNA-323a-3p promoted intracranial, aneurysm-induced inflammation via AMPK/NF-κB signaling pathway by AdipoR1. Sun B, Liu Z, Yu Z. Adv Clin Exp Med. 2022 Nov;31(11):1243-1254.

  • MiR-323a regulates ErbB3/EGFR and blocks gefitinib resistance acquisition in colorectal cancer. Zhang Y, Liang S, Xiao B, Hu J, Pang Y, Liu Y, Yang J, Ao J, Wei L, Luo X. Cell Death Dis. 2022 Mar 22;13(3):256.

  • Identification of serum exosomal miR-98-5p, miR-183-5p, miR-323-3p and miR-19b-3p as potential biomarkers for glioblastoma patients and investigation of their mechanisms. Yang Q, Wei B, Peng C, Wang L, Li C. Curr Res Transl Med. 2022 Jan;70(1):103315.

  • Suppression of microRNA-323-3p restrains vascular endothelial cell apoptosis via promoting sirtuin-1 expression in coronary heart disease. Du S, Shen S, Ding S, Wang L. Life Sci. 2021 Apr 1;270:119065.

  • miR-323a regulates ERBB4 and is involved in depression. Fiori LM, Kos A, Lin R, Théroux JF, Lopez JP, Kühne C, Eggert C, Holzapfel M, Huettl RE, Mechawar N, Belzung C, Ibrahim EC, Chen A, Turecki G. Mol Psychiatry. 2021 Aug;26(8):4191-4204.

  • Long non-coding RNA SNHG7 promotes neuroblastoma progression through sponging miR-323a-5p and miR-342-5p. Jia J, Zhang D, Zhang J, Yang L, Zhao G, Yang H, Wang J. Biomed Pharmacother. 2020 Aug;128:110293.

  • RIG-I regulates myeloid differentiation by promoting TRIM25-mediated ISGylation. Wu SF, Xia L, Shi XD, Dai YJ, Zhang WN, Zhao JM, Zhang W, Weng XQ, Lu J, Le HY, Tao SC, Zhu J, Chen Z, Wang YY, Chen S. Proc Natl Acad Sci U S A. 2020 Jun 23;117(25):14395-14404.

  • MiR-323-3p Targeting Transmembrane Protein with EGF-Like and 2 Follistatin Domain (TMEFF2) Inhibits Human Lung Cancer A549 Cell Apoptosis by Regulation of AKT and ERK Signaling Pathways. Fan JM, Zheng ZR, Zeng YM, Chen XY. Med Sci Monit. 2020 Feb 3;26:e919454.

  • Mesenchymal stem cells derived exosomal miR-323-3p promotes proliferation and inhibits apoptosis of cumulus cells in polycystic ovary syndrome (PCOS). Zhao Y, Tao M, Wei M, Du S, Wang H, Wang X. Artif Cells Nanomed Biotechnol. 2019 Dec;47(1):3804-3813.

  • Increased miR-323a induces bladder cancer cell apoptosis by suppressing c-Met. Qiu J, Zeng FR, Fang Y, Li J, Xiao SY. Kaohsiung J Med Sci. 2019 Sep;35(9):542-549.

  • Functional high-throughput screening reveals miR-323a-5p and miR-342-5p as new tumor-suppressive microRNA for neuroblastoma. Soriano A, Masanas M, Boloix A, Masiá N, París-Coderch L, Piskareva O, Jiménez C, Henrich KO, Roma J, Westermann F, Stallings RL, Sábado C, de Toledo JS, Santamaria A, Gallego S, Segura MF. Cell Mol Life Sci. 2019 Jun;76(11):2231-2243.

  • MicroRNA-323 suppresses nerve cell toxicity in cerebral infarction via the transforming growth factor-β1/SMAD3 signaling pathway. Che F, Du H, Wei J, Zhang W, Cheng Z, Tong Y. Int J Mol Med. 2019 Feb;43(2):993-1002.

  • miR-323-3p regulates the steroidogenesis and cell apoptosis in polycystic ovary syndrome (PCOS) by targeting IGF-1. Wang T, Liu Y, Lv M, Xing Q, Zhang Z, He X, Xu Y, Wei Z, Cao Y. Gene. 2019 Jan 30;683:87-100.

  • MiR-323a-3p suppressed the glycolysis of osteosarcoma via targeting LDHA. Chen H, Gao S, Cheng C. Hum Cell. 2018 Oct;31(4):300-309.

  • Haplotype-based association of two SNPs in miR-323b with unexplained recurrent spontaneous abortion in a Chinese Han population. Wang XQ, Li Y, Su X, Zhang L, Liu CM, Liu H, Ma X, Xia H. J Cell Physiol. 2018 Aug;233(8):6001-6017.

  • MET/SMAD3/SNAIL circuit mediated by miR-323a-3p is involved in regulating epithelial-mesenchymal transition progression in bladder cancer. Li J, Xu X, Meng S, Liang Z, Wang X, Xu M, Wang S, Li S, Zhu Y, Xie B, Lin Y, Zheng X, Liu B, Xie L. Cell Death Dis. 2017 Aug 24;8(8):e3010.

  • Circulating miR-323-3p is a biomarker for cardiomyopathy and an indicator of phenotypic variability in Friedreich's ataxia patients. Seco-Cervera M, González-Rodríguez D, Ibáñez-Cabellos JS, Peiró-Chova L, González-Cabo P, García-López E, Vílchez JJ, Sanz-Gallego I, Pallardó FV, García-Giménez JL. Sci Rep. 2017 Jul 12;7(1):5237.

  • Aberrant Expression of miR-323a-5p in Patients with Refractory Epilepsy Caused by Focal Cortical Dysplasia. Che N, Zu G, Zhou T, Wang X, Sun Y, Tan Z, Liu Y, Wang D, Luo X, Zhao Z, Zhang Y, Wei M, Yin J. Genet Test Mol Biomarkers. 2017 Jan;21(1):3-9.

  • Expression level of miRNAs on chromosome 14q32.31 region correlates with tumor aggressiveness and survival of glioblastoma patients. Shahar T, Granit A, Zrihan D, Canello T, Charbit H, Einstein O, Rozovski U, Elgavish S, Ram Z, Siegal T, Lavon I. J Neurooncol. 2016 Dec;130(3):413-422.

    • There are 36 references associated with hsa-mir-323a. Click here to see the complete list in PubMed.