Precursor miRNA: hsa-mir-19b-1

Precursor miRNA

Precursor Name hsa-mir-19b-1
Genomic Location chr13:91351192-91351278 (+); nearby genomic features
Clustered miRNAs hsa-mir-17,hsa-mir-18a,hsa-mir-19a,hsa-mir-20a,hsa-mir-19b-1,hsa-mir-92a-1 (within 10kb in genome)
NCBI GENE ID 406980
MIM ID 609419
miRBase ID MI0000074
Precursor Sequence 
     uu                 -  -      uc    ugugu
cacug  cuaugguuaguuuugca gg uuugca  cagc     g
|||||  ||||||||||||||||| || ||||||  ||||      a
gugau  ggugucagucaaaacgu cc aaacgu  gucg     u
     --                 a  u      --    ucuua

Mature miRNA

Mature Name hsa-miR-19b-3p
Previous Name hsa-miR-19b
Mature Sequence 5' - ugugcaaauccaugcaaaacuga - 3' (length = 23)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000074
Similar miRNAs hsa-miR-19a-3p (sharing the same seed sequence with hsa-miR-19b-3p).

References

  • Plasma miR-19b, miR-34a, and miR-146a expression in patients with type 2 diabetes mellitus and cataract: A pilot study. Milcu AI, Anghel FM, Romanescu M, Chis AR, Anghel A, Boruga O. Biomol Biomed. 2024 May 2;24(3):537-544.

  • MiRNA-19b-3p downregulates the endothelin B receptor in gastric cancer cells to prevent angiogenesis and proliferation. Hu X, Liu H, Li C. Acta Biochim Pol. 2023 May 25;70(2):363-370.

  • MicroRNA-19b-3p dysfunction of mesenchymal stem cell-derived exosomes from patients with abdominal aortic aneurysm impairs therapeutic efficacy. Zhang Y, Huang X, Sun T, Shi L, Liu B, Hong Y, Fu QL, Zhang Y, Li X. J Nanobiotechnology. 2023 Apr 26;21(1):135.

  • MiR-19 Family Impairs Adipogenesis by the Downregulation of the PPARγ Transcriptional Network. Juiz-Valiña P, Varela-Rodríguez BM, Outeiriño-Blanco E, García-Brao MJ, Mena E, Cordido F, Sangiao-Alvarellos S. Int J Mol Sci. 2022 Dec 13;23(24):15792.

  • UC-BSCs Exosomes Regulate Th17/Treg Balance in Patients with Systemic Lupus Erythematosus via miR-19b/KLF13. Tu J, Zheng N, Mao C, Liu S, Zhang H, Sun L. Cells. 2022 Dec 19;11(24):4123.

  • Oncogenic role of microRNA-19b-3p-mediated SOCS3 in glioma through activation of JAK-STAT pathway. Li T, Ge H, Yang Q, Wang J, Yin Q, Wang H, Hou G. Metab Brain Dis. 2023 Mar;38(3):945-960.

  • MiR-19b-3p Inhibits Hypoxia-Ischemia Encephalopathy by Inhibiting SOX6 Expression via Activating Wnt/β-catenin Pathway. Zeng H, Chen YX. Neurochem Res. 2023 Mar;48(3):874-884.

  • c-Jun-mediated miR-19b expression induces endothelial barrier dysfunction in an in vitro model of hemorrhagic shock. Wu F, Wang JY, Dorman B, Zeineddin A, Kozar RA. Mol Med. 2022 Oct 12;28(1):123.

  • Human Antigen R (HuR) Facilitates miR-19 Synthesis and Affects Cellular Kinetics in Papillary Thyroid Cancer. Gatti da Silva GH, Pereira Dos Santos MG, Nagasse HY, Pereira Coltri P. Cell Physiol Biochem. 2022 Mar 30;56:105-119.

  • MiR-19b-3p promotes tumor progression of non-small cell lung cancer via downregulating HOXA9 and predicts poor prognosis in patients. Li ZL, Li D, Yin GQ. Histol Histopathol. 2022 Aug;37(8):779-789.

  • miR-19b-3p is associated with a diametric response to resistance exercise in older adults and regulates skeletal muscle anabolism via PTEN inhibition. Rivas DA, Peng F, Benard T, Ramos da Silva AS, Fielding RA, Margolis LM. Am J Physiol Cell Physiol. 2021 Dec 1;321(6):C977-C991.

  • Endurance exercise training-responsive miR-19b-3p improves skeletal muscle glucose metabolism. Massart J, Sjögren RJO, Egan B, Garde C, Lindgren M, Gu W, Ferreira DMS, Katayama M, Ruas JL, Barrès R, O'Gorman DJ, Zierath JR, Krook A. Nat Commun. 2021 Oct 12;12(1):5948.

  • MicroRNA miR-19b-3p mediated G protein γ subunit 7 (GNG7) loss contributes lung adenocarcinoma progression through activating Hedgehog signaling. Zhao X, Zhang XC, Zang K, Yu ZH. Bioengineered. 2021 Dec;12(1):7849-7858.

  • Tumor-derived exosomal miR-19b-3p facilitates M2 macrophage polarization and exosomal LINC00273 secretion to promote lung adenocarcinoma metastasis via Hippo pathway. Chen J, Zhang K, Zhi Y, Wu Y, Chen B, Bai J, Wang X. Clin Transl Med. 2021 Sep;11(9):e478.

  • Knockdown of lncRNA XIST inhibited apoptosis and inflammation in renal fibrosis via microRNA-19b-mediated downregulation of SOX6. Xia WP, Chen X, Ru F, He Y, Liu PH, Gan Y, Zhang B, Li Y, Dai GY, Jiang ZX, Chen Z. Mol Immunol. 2021 Nov;139:87-96.

  • Long noncoding RNA SNHG20 regulates cell migration, invasion, and proliferation via the microRNA-19b-3p/RAB14 axis in oral squamous cell carcinoma. Zhu X, Zhang H, Xu J. Bioengineered. 2021 Dec;12(1):3993-4003.

  • MYPT1, regulated by miR-19b-3p inhibits the progression of non-small cell lung cancer via inhibiting the activation of wnt/β-catenin signaling. Wang Y, Wang L, Guo J, Zuo S, Wang Z, Hua S. Life Sci. 2021 Aug 1;278:119573.

  • Altered expression of serum miR-106a, miR-19b, miR-17, and PTEN in patients with idiopathic membranous nephropathy. Wu L, Zhang X, Luo L, Li X, Liu Y, Qin X. J Clin Lab Anal. 2021 Apr;35(4):e23737.

  • Bone marrow mesenchymal stem cells-derived exosomal microRNA-19b-1-5p reduces proliferation and raises apoptosis of bladder cancer cells via targeting ABL2. Fu D, Liu B, Jiang H, Li Z, Fan C, Zang L. Genomics. 2021 May;113(3):1338-1348.

  • The miR-19b-3p-MAP2K3-STAT3 feedback loop regulates cell proliferation and invasion in esophageal squamous cell carcinoma. Zhang Y, Lu W, Chen Y, Lin Y, Yang X, Wang H, Liu Z. Mol Oncol. 2021 May;15(5):1566-1583.

    • There are 113 references associated with hsa-mir-19b-1. Click here to see the complete list in PubMed.