Precursor miRNA: hsa-mir-19a

Precursor miRNA

Precursor Name hsa-mir-19a
Genomic Location chr13:91350891-91350972 (+); nearby genomic features
Clustered miRNAs hsa-mir-17,hsa-mir-18a,hsa-mir-19a,hsa-mir-20a,hsa-mir-19b-1,hsa-mir-92a-1 (within 10kb in genome)
NCBI GENE ID 406979
MIM ID 609418
miRBase ID MI0000073
Precursor Sequence 
    u  u                 --      ---    ag
gcag cc cuguuaguuuugcauag  uugcac   uaca  a
|||| || |||||||||||||||||  ||||||   ||||   a
cguc gg gguagucaaaacguauc  aacgug   augu  g
    c  u                 ua      uug    aa

Mature miRNA

Mature Name hsa-miR-19a-3p
Previous Name hsa-miR-19a
Mature Sequence 5' - ugugcaaaucuaugcaaaacuga - 3' (length = 23)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000073
Similar miRNAs hsa-miR-19b-3p (sharing the same seed sequence with hsa-miR-19a-3p).

References

  • MicroRNA-19a-3p inhibits endothelial dysfunction in atherosclerosis by targeting JCAD. Luo J, Wang L, Cui C, Chen H, Zeng W, Li X. BMC Cardiovasc Disord. 2024 Jul 30;24(1):394.

  • Next-generation sequencing reveals that miR-16-5p, miR-19a-3p, miR-451a, and miR-25-3p cargo in plasma extracellular vesicles differentiates sedentary young males from athletes. Fernandez-Sanjurjo M, Pinto-Hernandez P, Dávalos A, Díaz-Martínez ÁE, Martín-Hernández R, Castilla-Silgado J, Toyos-Rodríguez C, Whitham M, Amado-Rodríguez L, Muñiz-Albaiceta G, Terrados N, Fernández-García B, Iglesias-Gutiérrez E. Eur J Sport Sci. 2024 Jun;24(6):766-776.

  • LncRNA HOTAIR Inhibits miR-19a-3p to Alleviate Foam Cell Formation and Inflammatory Response in Atherosclerosis. Chen H, Li X, Chen W, Wu T, Liu S. Int J Med Sci. 2024 Jan 12;21(3):521-529.

  • Long non-coding RNA NBR2 suppresses the progression of colorectal cancer by downregulating miR-19a to regulate M2 macrophage polarization. Yang X, Luo Y, Li M, Jin Z, Chen G, Gan C. Chin J Physiol. 2023 Nov-Dec;66(6):546-557.

  • H19 encourages aerobic glycolysis and cell growth in gastric cancer cells through the axis of microRNA-19a-3p and phosphoglycerate kinase 1. Chen S, Wang H, Xu P, Dang S, Tang Y. Sci Rep. 2023 Oct 11;13(1):17181.

  • Extracellular vesicles from cerebrospinal fluid revealed changes in miR-19a-3p and miR-4516 expression in Slovene male suicides. Å alamon Arčan I, KatraÅ¡nik M, Kouter K, Zupanc T, Videtič Paska A. Genes Brain Behav. 2023 Dec;22(6):e12868.

  • LINC00844 suppresses tumor progression and predicts survival outcomes through inhibiting miR-19a-5p in cholangiocarcinoma. Zhang L, Jiang G, Lu J, Wang L. Clin Transl Oncol. 2024 Feb;26(2):414-423.

  • miR-19a-3p affected ox-LDL-induced SDC-1/TGF-β1/Smad3 pathway in atherosclerosis. Jin Q, Deng Y, Li L, Chen R, Jiang L. Cell Mol Biol (Noisy-le-grand). 2023 Mar 31;69(3):75-81.

  • Overexpressed RBPMS-AS1 increased cell radiosensitivity by sponging miR-19a-3p in lung cancer cell lines (A549 and SK-MES-1) via regulating PTEN/AKT axis. Ye C, Lin Q, Zheng C. Int J Radiat Biol. 2023;99(9):1352-1363.

  • The Serum/Glucocorticoid-Regulated Kinase 1 Is Targeted by miR-19a in CD4+ T Cells. Weidner J, Malmhäll C, Arabkari V, Barrett A, Boberg E, Ekerljung L, Rådinger M. Cells. 2022 Dec 29;12(1):133.

  • MiR-19a-3p Promotes Aerobic Glycolysis in Ovarian Cancer Cells via IGFBP3/PI3K/AKT Pathway. Du L, Dou K, Zhang D, Xia H, Liang N, Wang N, Sun J, Bai R. Folia Biol (Praha). 2023;69(5-6):163-172.

  • MiR-19 Family Impairs Adipogenesis by the Downregulation of the PPARγ Transcriptional Network. Juiz-Valiña P, Varela-Rodríguez BM, Outeiriño-Blanco E, García-Brao MJ, Mena E, Cordido F, Sangiao-Alvarellos S. Int J Mol Sci. 2022 Dec 13;23(24):15792.

  • Upregulation of miR-184 and miR-19a-3p induces endothelial dysfunction by targeting AGO2 in Kawasaki disease. Liao J, Guo X, Fan X, Zhang X, Xu M. Cardiol Young. 2023 Oct;33(10):1962-1966.

  • METTL3-mediated m6A modification promotes processing and maturation of Gong Y, Jiang Q, Liu L, Liao Q, Yu J, Xiang Z, Luo X. Physiol Genomics. 2022 Sep 1;54(9):337-349.

  • Respiratory Syncytial Virus Nonstructural Protein 1 Promotes 5-Lipoxygenase via miR-19a-3p. Zheng M, Fan P, Yang P, Zheng J, Zhao D. J Immunol Res. 2022 May 20;2022:4086710.

  • MiR-19a suppresses ferroptosis of colorectal cancer cells by targeting IREB2. Fan H, Ai R, Mu S, Niu X, Guo Z, Liu L. Bioengineered. 2022 May;13(5):12021-12029.

  • MicroRNA-19a-3p Acts as an Oncogene in Gastric Cancer and Exerts the Effect by Targeting SMOC2. Xu H, Lu G, Zhou S, Fang F. Appl Biochem Biotechnol. 2022 Sep;194(9):3833-3842.

  • Human Antigen R (HuR) Facilitates miR-19 Synthesis and Affects Cellular Kinetics in Papillary Thyroid Cancer. Gatti da Silva GH, Pereira Dos Santos MG, Nagasse HY, Pereira Coltri P. Cell Physiol Biochem. 2022 Mar 30;56:105-119.

  • <em>miR-19a</em> targeting <em>CLCA4</em> to regulate the proliferation, migration, and invasion of colorectal cancer cells. Li H, Huang B. Eur J Histochem. 2022 Mar 10;66(1):3381.

  • Exosomal miR-19a decreases insulin production by targeting Neurod1 in pancreatic cancer associated diabetes. Su J, Pang W, Zhang A, Li L, Yao W, Dai X. Mol Biol Rep. 2022 Mar;49(3):1711-1720.

    • There are 186 references associated with hsa-mir-19a. Click here to see the complete list in PubMed.