Precursor miRNA: mmu-mir-451a

Precursor miRNA

Precursor Name mmu-mir-451a
Genomic Location chr11:78073170-78073241 (+); nearby genomic features
Clustered miRNAs mmu-mir-144,mmu-mir-451a,mmu-mir-451b (within 10kb in genome)
NCBI GENE ID 723870
miRBase ID MI0001730
Precursor Sequence 
cu     au      ga                 a
  uggga  ggcgag  aaccguuaccauuacug g
  |||||  ||||||  ||||||||||||||||| 
  acccu  ucguuc  uuggcaaugguaaugau u
ac     cg      uc                 u

Mature miRNA

Mature Name mmu-miR-451a
Previous Name mmu-miR-451
Mature Sequence 5' - aaaccguuaccauuacugaguu - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0001632

References

  • MiR-144/451 attenuates lipopolysaccharide-induced lung inflammation by downregulating Rac1 and STAT-3 in macrophages. He S, Gao X, Yang L, Li X, Mo Y, He Z, Hou R, Yuan X, Fang L, Yu D. J Biochem Mol Toxicol. 2024 Nov;38(11):e70006.

  • Crosstalk between Yang L, He S, Ling L, Wang F, Xu L, Fang L, Wu F, Zhou S, Yang F, Wei H, Yu D. Genes (Basel). 2023 Apr 29;14(5):1011.

  • microRNA-144/451 decreases dendritic cell bioactivity Lin Z, Xie X, Gu M, Chen Q, Lu G, Jia X, Xiao W, Zhang J, Yu D, Gong W. Front Immunol. 2022 Jul 29;13:928593.

  • MicroRNA-451a attenuates angiotensin II-induced cardiac fibrosis and inflammation by directly targeting T-box1. Deng HY, He ZY, Dong ZC, Zhang YL, Han X, Li HH. J Physiol Biochem. 2022 Feb;78(1):257-269.

  • miRNA-451 regulates the NF-κB signaling pathway by targeting IKKβ to inhibit glioma cell growth. Nan Y, Guo L, Zhen Y, Wang L, Ren B, Chen X, Lu Y, Yu K, Zhong Y, Huang Q. Cell Cycle. 2021 Oct;20(19):1967-1977.

  • Reprogrammed lung epithelial cells by decrease of miR-451a in extracellular vesicles contribute to aggravation of pulmonary fibrosis. Jeong MH, Kim HR, Park YJ, Chung KH, Kim HS. Cell Biol Toxicol. 2022 Oct;38(5):725-740.

  • MiR-451a enhances the phagocytosis and affects both M1 and M2 polarization in macrophages. Liu X, Zhang D, Wang H, Ren Q, Li B, Wang L, Zheng G. Cell Immunol. 2021 Jul;365:104377.

  • miR-451a levels rather than human papillomavirus vaccine administration is associated with the severity of murine experimental autoimmune encephalomyelitis. Nakashima M, Ishikawa K, Fugiwara A, Shu K, Fukushima Y, Okamoto M, Tsukamoto H, Kouwaki T, Oshiumi H. Sci Rep. 2021 Apr 30;11(1):9369.

  • Exosomes containing miR-451a is involved in the protective effect of cerebral ischemic preconditioning against cerebral ischemia and reperfusion injury. Li H, Luo Y, Liu P, Liu P, Hua W, Zhang Y, Zhang L, Li Z, Xing P, Zhang Y, Hong B, Yang P, Liu J. CNS Neurosci Ther. 2021 May;27(5):564-576.

  • CAP1, a target of miR-144/451, negatively regulates erythroid differentiation and enucleation. Huang X, Chao R, Zhang Y, Wang P, Gong X, Liang D, Wang Y. J Cell Mol Med. 2021 Mar;25(5):2377-2389.

  • miR-144/451 inhibits c-Myc to promote erythroid differentiation. Xu L, Wu F, Yang L, Wang F, Zhang T, Deng X, Zhang X, Yuan X, Yan Y, Li Y, Yang Z, Yu D. FASEB J. 2020 Oct;34(10):13194-13210.

  • MiR-451a ameliorates alcoholic hepatitis via repressing HDAC8-mediated proinflammatory response. Du B, Tan XH, Cheng L, Wang F, Zhang HF. Kaohsiung J Med Sci. 2020 Nov;36(11):904-910.

  • Inhibition of microRNA-451 is associated with increased expression of Macrophage Migration Inhibitory Factor and mitgation of the cardio-pulmonary phenotype in a murine model of Bronchopulmonary Dysplasia. Gilfillan M, Das P, Shah D, Alam MA, Bhandari V. Respir Res. 2020 Apr 22;21(1):92.

  • Ablation of miR-144 increases vimentin expression and atherosclerotic plaque formation. He Q, Wang F, Honda T, Greis KD, Redington AN. Sci Rep. 2020 Apr 9;10(1):6127.

  • MiRNA-451a inhibits airway remodeling by targeting Cadherin 11 in an allergic asthma model of neonatal mice. Wang T, Zhou Q, Shang Y. Int Immunopharmacol. 2020 Jun;83:106440.

  • Depletion of microRNA-451 in response to allergen exposure accentuates asthmatic inflammation by regulating Sirtuin2. Chung S, Lee YG, Karpurapu M, Englert JA, Ballinger MN, Davis IC, Park GY, Christman JW. Am J Physiol Lung Cell Mol Physiol. 2020 May 1;318(5):L921-L930.

  • Suppression of miR-451a accelerates osteogenic differentiation and inhibits bone loss via Bmp6 signaling during osteoporosis. Lu XD, Han WX, Liu YX. Biomed Pharmacother. 2019 Dec;120:109378.

  • Deletion of miR-451 curbs JAK2(V617F)-induced erythrocytosis in polycythemia vera by oxidative stress-mediated erythroblast apoptosis and hemolysis. Yao H, Ma Y, Huang LJ. Haematologica. 2020 Apr;105(4):e153-e156.

  • miR-451 Silencing Inhibited Doxorubicin Exposure-Induced Cardiotoxicity in Mice. Li J, Wan W, Chen T, Tong S, Jiang X, Liu W. Biomed Res Int. 2019 Jul 4;2019:1528278.

  • Regulation of gene expression by miR-144/451 during mouse erythropoiesis. Xu P, Palmer LE, Lechauve C, Zhao G, Yao Y, Luan J, Vourekas A, Tan H, Peng J, Schuetz JD, Mourelatos Z, Wu G, Weiss MJ, Paralkar VR. Blood. 2019 Jun 6;133(23):2518-2528.

    • There are 76 references associated with mmu-mir-451a. Click here to see the complete list in PubMed.