Precursor miRNA: mmu-mir-429

Precursor miRNA

Precursor Name mmu-mir-429
Genomic Location chr4:156053905-156053987 (-); nearby genomic features
Clustered miRNAs mmu-mir-429,mmu-mir-200a,mmu-mir-200b (within 10kb in genome)
NCBI GENE ID 723865
miRBase ID MI0001642
Precursor Sequence 
c   cu        u -          ug       cu   u
 cug  gauggaug c uuaccagaca  guuagau  gga g
 |||  |||||||| | ||||||||||  |||||||  ||| 
 ggc  cuaccugc g aauggucugu  uaaucug  ucu c
c   ac        c u          ca       --   a

Mature miRNA

Mature Name mmu-miR-429-3p
Previous Name mmu-miR-429
Mature Sequence 5' - uaauacugucugguaaugccgu - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0001537
Similar miRNAs mmu-miR-200b-3p, mmu-miR-200c-3p (sharing the same seed sequence with mmu-miR-429-3p).

References

  • Exosomes enriched by miR-429-3p derived from ITGB1 modified Telocytes alleviates hypoxia-induced pulmonary arterial hypertension through regulating Rac1 expression. Qi R, Zhang Y, Yan F. Cell Biol Toxicol. 2024 May 20;40(1):32.

  • RUNX1/miR-429 feedback loop promotes growth, metastasis, and epithelial-mesenchymal transition in oral squamous cell carcinoma by targeting ITGB1. Lu X, Yang Y, Chen J, Zhao T, Zhao X. Naunyn Schmiedebergs Arch Pharmacol. 2024 Jul;397(7):5289-5302.

  • TBX1 targets the miR-200-ZEB2 axis to induce epithelial differentiation and inhibit stem cell properties. Funato N, Yanagisawa H. Sci Rep. 2022 Nov 23;12(1):20188.

  • miR-429 negatively regulates the progression of hypoxia-induced retinal neovascularization by the HPSE-VEGF pathway. Xu H, Yang B, Ren Z, Wu D, Hu A, Hu J. Exp Eye Res. 2022 Oct;223:109196.

  • MicroRNA-200c/429 mediated regulation of Zeb1 augments N-Cadherin in mouse cardiac mesenchymal cells. Nath AV, Ajit S, Sekar AJ, P R AK, Muthusamy S. Cell Biol Int. 2022 Feb;46(2):222-233.

  • The miR-200 family is required for ectodermal organ development through the regulation of the epithelial stem cell niche. Sweat M, Sweat Y, Yu W, Su D, Leonard RJ, Eliason SL, Amendt BA. Stem Cells. 2021 Jun;39(6):761-775.

  • MiR-429 Involves in the Pathogenesis of Colorectal Cancer via Directly Targeting LATS2. Chen X, Wang AL, Liu YY, Zhao CX, Zhou X, Liu HL, Lin MB. Oxid Med Cell Longev. 2020 Dec 19;2020:5316276.

  • Cold-induced Yes-associated-protein expression through miR-429 mediates the browning of white adipose tissue. Ye C, Duan J, Zhang X, Yao L, Song Y, Wang G, Li Q, Wang B, Ai D, Wang C, Zhu Y. Sci China Life Sci. 2021 Mar;64(3):404-418.

  • Inactivation of Carpinelli MR, de Vries ME, Auden A, Butt T, Deng Z, Partridge DD, Miles LB, Georgy SR, Haigh JJ, Darido C, Brabletz S, Brabletz T, Stemmler MP, Dworkin S, Jane SM. Dis Model Mech. 2020 Mar 25;13(3):dmm042218.

  • LncRNA GAS5 suppresses inflammatory responses and apoptosis of alveolar epithelial cells by targeting miR-429/DUSP1. Li J, Liu S. Exp Mol Pathol. 2020 Apr;113:104357.

  • Long non-coding RNA MALAT1 sponges microRNA-429 to regulate apoptosis of hippocampal neurons in hypoxic-ischemic brain damage by regulating WNT1. Fang H, Li HF, He MH, Yan JY, Yang M, Zhang FX, Wang RR, Wang QY, Zhang JP. Brain Res Bull. 2019 Oct;152:1-10.

  • The spatiotemporal expression pattern of microRNAs in the developing mouse nervous system. Shu P, Wu C, Liu W, Ruan X, Liu C, Hou L, Zeng Y, Fu H, Wang M, Chen P, Zhang X, Yin B, Yuan J, Qiang B, Peng X. J Biol Chem. 2019 Mar 8;294(10):3444-3453.

  • MicroRNA 429 regulates the expression of CHMP5 in the inflammatory colitis and colorectal cancer cells. Mo JS, Han SH, Yun KJ, Chae SC. Inflamm Res. 2018 Dec;67(11-12):985-996.

  • Inhibition of microRNA-429 attenuates oxygen-glucose deprivation/reoxygenation-induced neuronal injury by promoting expression of GATA-binding protein 4. Xiao J, Kong R, Hu J. Neuroreport. 2018 Jun 13;29(9):723-730.

  • The microRNA-200 family coordinately regulates cell adhesion and proliferation in hair morphogenesis. Hoefert JE, Bjerke GA, Wang D, Yi R. J Cell Biol. 2018 Jun 4;217(6):2185-2204.

  • ZEB1, ZEB2, and the miR-200 family form a counterregulatory network to regulate CD8 Guan T, Dominguez CX, Amezquita RA, Laidlaw BJ, Cheng J, Henao-Mejia J, Williams A, Flavell RA, Lu J, Kaech SM. J Exp Med. 2018 Apr 2;215(4):1153-1168.

  • MiR-194 is involved in morphogenesis of spiral ganglion neurons in inner ear by rearranging actin cytoskeleton via targeting RhoB. Du J, Zhang X, Cao H, Jiang D, Wang X, Zhou W, Chen K, Zhou J, Jiang H, Ba L. Int J Dev Neurosci. 2017 Dec;63:16-26.

  • Overexpression of miR-429 impairs intestinal barrier function in diabetic mice by down-regulating occludin expression. Yu T, Lu XJ, Li JY, Shan TD, Huang CZ, Ouyang H, Yang HS, Xu JH, Zhong W, Xia ZS, Chen QK. Cell Tissue Res. 2016 Nov;366(2):341-352.

  • Adipocyte miR-200b/a/429 ablation in mice leads to high-fat-diet-induced obesity. Tao C, Ren H, Xu P, Cheng J, Huang S, Zhou R, Mu Y, Yang S, Qi D, Wang Y, Li K. Oncotarget. 2016 Oct 18;7(42):67796-67807.

  • Hypoxia-Induced MicroRNA-429 Promotes Differentiation of MC3T3-E1 Osteoblastic Cells by Mediating ZFPM2 Expression. Huang J, Peng J, Cao G, Lu S, Liu L, Li Z, Zhou M, Feng M, Shen H. Cell Physiol Biochem. 2016;39(3):1177-86.

    • There are 45 references associated with mmu-mir-429. Click here to see the complete list in PubMed.