Precursor miRNA: mmu-mir-381

Precursor miRNA

Precursor Name mmu-mir-381
Genomic Location chr12:109726822-109726896 (+); nearby genomic features
Clustered miRNAs mmu-mir-666,mmu-mir-543,mmu-mir-495,mmu-mir-667,mmu-mir-376c,mmu-mir-654,mmu-mir-376b,mmu-mir-376a,mmu-mir-300,mmu-mir-381,mmu-mir-487b,mmu-mir-539,mmu-mir-544,mmu-mir-382,mmu-mir-134,mmu-mir-668,mmu-mir-485,mmu-mir-453 (within 10kb in genome)
NCBI GENE ID 723935
miRBase ID MI0000798
Precursor Sequence 
      a  c   g        u        --g   u
uacuua ag gag uugcccuu guauauuc   guu a
|||||| || ||| |||||||| ||||||||   ||| 
augagu uc cuc aacgggaa cauauaag   cag u
      g  u   g        -        gua   u

Mature miRNA

Mature Name mmu-miR-381-3p
Previous Name mmu-miR-381
Mature Sequence 5' - uauacaagggcaagcucucugu - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000746
Similar miRNAs mmu-miR-539-3p (sharing the same seed sequence with mmu-miR-381-3p).

References

  • Silencing of maternally expressed RNAs in Dlk1-Dio3 domain causes fatal vascular injury in the fetal liver. Yu H, Zhao Y, Cheng R, Wang M, Hu X, Zhang X, Teng X, He H, Han Z, Han X, Wang Z, Liu B, Zhang Y, Wu Q. Cell Mol Life Sci. 2024 Oct 9;81(1):429.

  • Diabetic Macrophage Exosomal miR-381-3p Inhibits Epithelial Cell Autophagy Via NR5A2. Huang X, Wei L, Li M, Zhang Y, Kuang S, Shen Z, Liu H, Lin Z. Int Dent J. 2024 Aug;74(4):823-835.

  • Maternal RNA transcription in Dlk1-Dio3 domain is critical for proper development of the mouse placental vasculature. Zhang X, He H, Yu H, Teng X, Wang Z, Li C, Li J, Yang H, Shen J, Wu T, Zhang F, Zhang Y, Wu Q. Commun Biol. 2024 Mar 23;7(1):363.

  • Neuroprotective microRNA-381 Binds to Repressed Early Growth Response 1 (EGR1) and Alleviates Oxidative Stress Injury in Parkinson's Disease. Guo S, Gao Y, Zhao Y. ACS Chem Neurosci. 2023 Jun 7;14(11):1981-1991.

  • ADAR1- and ADAR2-mediated regulation of maturation and targeting of miR-376b to modulate GABA neurotransmitter catabolism. Widmark A, Sagredo EA, Karlström V, Behm M, Biryukova I, Friedländer MR, Daniel C, Öhman M. J Biol Chem. 2022 Mar;298(3):101682.

  • Dexmedetomidine Ameliorates Postoperative Cognitive Dysfunction via the MicroRNA-381-Mediated EGR1/p53 Axis. Wang YL, Zhang Y, Cai DS. Mol Neurobiol. 2021 Oct;58(10):5052-5066.

  • microRNA-381-3p Confers Protection Against Ischemic Stroke Through Promoting Angiogenesis and Inhibiting Inflammation by Suppressing Cebpb and Map3k8. Li J, Lv H, Che Y. Cell Mol Neurobiol. 2020 Nov;40(8):1307-1319.

  • miR-381 Attenuates Peripheral Neuropathic Phenotype Caused by Overexpression of PMP22. Lee JS, Kwak G, Kim HJ, Park HT, Choi BO, Hong YB. Exp Neurobiol. 2019 Apr;28(2):279-288.

  • MiR-381 negatively regulates cardiomyocyte survival by suppressing Notch signaling. Lu L, Zhang H, Dong W, Peng W, Yang J. In Vitro Cell Dev Biol Anim. 2018 Sep;54(8):610-619.

  • Circulating miRs-183-5p, -206-3p and -381-3p may serve as novel biomarkers for 4,4'-methylene diphenyl diisocyanate exposure. Lin CC, Law BF, Siegel PD, Hettick JM. Biomarkers. 2019 Feb;24(1):76-90.

  • miR-381-3p knockdown improves intestinal epithelial proliferation and barrier function after intestinal ischemia/reperfusion injury by targeting nurr1. Liu L, Yao J, Li Z, Zu G, Feng D, Li Y, Qasim W, Zhang S, Li T, Zeng H, Tian X. Cell Death Dis. 2018 Mar 14;9(3):411.

  • MicroRNA-381 Regulates Chondrocyte Hypertrophy by Inhibiting Histone Deacetylase 4 Expression. Chen W, Sheng P, Huang Z, Meng F, Kang Y, Huang G, Zhang Z, Liao W, Zhang Z. Int J Mol Sci. 2016 Aug 23;17(9):1377.

  • miR-26a and miR-384-5p are required for LTP maintenance and spine enlargement. Gu QH, Yu D, Hu Z, Liu X, Yang Y, Luo Y, Zhu J, Li Z. Nat Commun. 2015 Apr 10;6:6789.

  • The miR-379/miR-410 cluster at the imprinted Dlk1-Dio3 domain controls neonatal metabolic adaptation. Labialle S, Marty V, Bortolin-Cavaillé ML, Hoareau-Osman M, Pradère JP, Valet P, Martin PG, Cavaillé J. EMBO J. 2014 Oct 1;33(19):2216-30.

  • A-to-I editing of microRNAs in the mammalian brain increases during development. Ekdahl Y, Farahani HS, Behm M, Lagergren J, Öhman M. Genome Res. 2012 Aug;22(8):1477-87.

  • A resource of vectors and ES cells for targeted deletion of microRNAs in mice. Prosser HM, Koike-Yusa H, Cooper JD, Law FC, Bradley A. Nat Biotechnol. 2011 Aug 7;29(9):840-5.

  • A high-resolution anatomical atlas of the transcriptome in the mouse embryo. Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, Magen A, Canidio E, Pagani M, Peluso I, Lin-Marq N, Koch M, Bilio M, Cantiello I, Verde R, De Masi C, Bianchi SA, Cicchini J, Perroud E, Mehmeti S, Dagand E, Schrinner S, Nürnberger A, Schmidt K, Metz K, Zwingmann C, Brieske N, Springer C, Hernandez AM, Herzog S, Grabbe F, Sieverding C, Fischer B, Schrader K, Brockmeyer M, Dettmer S, Helbig C, Alunni V, Battaini MA, Mura C, Henrichsen CN, Garcia-Lopez R, Echevarria D, Puelles E, Garcia-Calero E, Kruse S, Uhr M, Kauck C, Feng G, Milyaev N, Ong CK, Kumar L, Lam M, Semple CA, Gyenesei A, Mundlos S, Radelof U, Lehrach H, Sarmientos P, Reymond A, Davidson DR, Dollé P, Antonarakis SE, Yaspo ML, Martinez S, Baldock RA, Eichele G, Ballabio A. PLoS Biol. 2011 Jan 18;9(1):e1000582.

  • Species-specific microRNA roles elucidated following astrocyte activation. Mor E, Cabilly Y, Goldshmit Y, Zalts H, Modai S, Edry L, Elroy-Stein O, Shomron N. Nucleic Acids Res. 2011 May;39(9):3710-23.

  • miRBase: integrating microRNA annotation and deep-sequencing data. Kozomara A, Griffiths-Jones S. Nucleic Acids Res. 2011 Jan;39(Database issue):D152-7.

  • miRNA 34a, 100, and 137 modulate differentiation of mouse embryonic stem cells. Tarantino C, Paolella G, Cozzuto L, Minopoli G, Pastore L, Parisi S, Russo T. FASEB J. 2010 Sep;24(9):3255-63.

    • There are 26 references associated with mmu-mir-381. Click here to see the complete list in PubMed.