Precursor miRNA: mmu-mir-27b



Precursor miRNA

Precursor Name mmu-mir-27b
Genomic Location chr13:63300712-63300784 (+); nearby genomic features
Clustered miRNAs mmu-mir-23b,mmu-mir-27b,mmu-mir-3074-1,mmu-mir-24-1 (within 10kb in genome)
NCBI GENE ID 387221
miRBase ID MI0000142
Precursor Sequence
                  auug        ugau   
aggugcagagcuuagcug    gugaacag    uggu
||||||||||||||||||    ||||||||    ||| u
uccacgucuugaaucggu    cacuuguu    gccu
                  --ga        --uc   

Mature miRNA

Mature Name mmu-miR-27b-3p
Previous Name mmu-miR-27b
Mature Sequence 5' - uucacaguggcuaaguucugc - 3' (length = 21)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000126
Similar miRNAs mmu-miR-27a-3p (sharing the same seed sequence with mmu-miR-27b-3p).

References


  • MBNL splicing factors regulate the microtranscriptome of skeletal muscles. Piasecka A, SzczeÅ›niak MW, Sekrecki M, Kajdasz A, Sznajder ŁJ, Baud A, Sobczak K. Nucleic Acids Res. 2024 Oct 28;52(19):12055-12073.

  • miR-27b-3p reduces muscle fibrosis during chronic skeletal muscle injury by targeting TGF-βR1/Smad pathway. Yao H, Qian J, Bian XT, Guo L, Tang KL, Tao X. J Orthop Surg Res. 2024 Jun 2;19(1):329.

  • The crucial relationship between miRNA-27 and CSE/H Gao S, Li Y, Liu MM, Xiong X, Cui CP, Huo QJ, Li KX, Sun X, Zhang R, Wu D, Li BY. Int J Med Sci. 2024 Mar 31;21(5):965-977.

  • The potential of leptin to alleviate chronic heart failure through miR-27a/b-3p: A preclinical study. Yan J, Xiao J, Duan J, Hong T. Asian J Surg. 2023 Dec;46(12):6099-6100.

  • Exosomal miR-27b-3p secreted by visceral adipocytes contributes to endothelial inflammation and atherogenesis. Tang Y, Yang LJ, Liu H, Song YJ, Yang QQ, Liu Y, Qian SW, Tang QQ. Cell Rep. 2023 Jan 31;42(1):111948.

  • MicroRNA miR-27b-3p regulate microglial inflammation response and cell apoptosis by inhibiting A20 (TNF-α-induced protein 3). Li L, Qi C, Liu Y, Shen Y, Zhao X, Qin H, Zhang Y, Yu T. Bioengineered. 2021 Dec;12(2):9902-9913.

  • miR-27b-3p a Negative Regulator of DSB-DNA Repair. Peraza-Vega RI, Valverde M, Rojas E. Genes (Basel). 2021 Aug 27;12(9):1333.

  • MicroRNA-27b-3p down-regulates FGF1 and aggravates pathological cardiac remodelling. Li G, Shao Y, Guo HC, Zhi Y, Qiao B, Ma K, Du J, Lai YQ, Li Y. Cardiovasc Res. 2022 Jul 20;118(9):2139-2151.

  • miR-24 controls the regenerative competence of hair follicle progenitors by targeting Plk3. Liu F, Zhang X, Peng Y, Zhang L, Yu Y, Hua P, Zhu P, Yan X, Li Y, Zhang L. Cell Rep. 2021 Jun 8;35(10):109225.

  • Effect of Chronic Western Diets on Non-Alcoholic Fatty Liver of Male Mice Modifying the PPAR-γ Pathway via miR-27b-5p Regulation. Zhang J, Powell CA, Kay MK, Sonkar R, Meruvu S, Choudhury M. Int J Mol Sci. 2021 Feb 12;22(4):1822.

  • microRNA-27b shuttled by mesenchymal stem cell-derived exosomes prevents sepsis by targeting JMJD3 and downregulating NF-κB signaling pathway. Sun J, Sun X, Chen J, Liao X, He Y, Wang J, Chen R, Hu S, Qiu C. Stem Cell Res Ther. 2021 Jan 7;12(1):14.

  • MicroRNA-27 attenuates pressure overload-Induced cardiac hypertrophy and dysfunction by targeting galectin-3. Zhang M, Cheng K, Chen H, Tu J, Shen Y, Pang L, Wu W. Arch Biochem Biophys. 2020 Aug 15;689:108405.

  • Up-Regulated MicroRNA-27b Promotes Adipocyte Differentiation via Induction of Acyl-CoA Thioesterase 2 Expression. Murata Y, Yamashiro T, Kessoku T, Jahan I, Usuda H, Tanaka T, Okamoto T, Nakajima A, Wada K. Biomed Res Int. 2019 Dec 10;2019:2916243.

  • MicroRNA-27b-3p inhibits apoptosis of chondrocyte in rheumatoid arthritis by targeting HIPK2. Zhou Y, Li S, Chen P, Yang B, Yang J, Liu R, Li J, Xia D. Artif Cells Nanomed Biotechnol. 2019 Dec;47(1):1766-1771.

  • MiRNA-27b Regulates Angiogenesis by Targeting AMPK in Mouse Ischemic Stroke Model. Yuan Y, Zhang Z, Wang Z, Liu J. Neuroscience. 2019 Feb 1;398:12-22.

  • MicroRNA-27b Modulates Inflammatory Response and Apoptosis during Liang S, Song Z, Wu Y, Gao Y, Gao M, Liu F, Wang F, Zhang Y. J Immunol. 2018 May 15;200(10):3506-3518.

  • Chronic hyperinsulinemia induced miR-27b is linked to adipocyte insulin resistance by targeting insulin receptor. Srivastava A, Shankar K, Beg M, Rajan S, Gupta A, Varshney S, Kumar D, Gupta S, Mishra RK, Gaikwad AN. J Mol Med (Berl). 2018 Apr;96(3-4):315-331.

  • LncRNA Gm15290 sponges miR-27b to promote PPARγ-induced fat deposition and contribute to body weight gain in mice. Liu W, Ma C, Yang B, Yin C, Zhang B, Xiao Y. Biochem Biophys Res Commun. 2017 Nov 25;493(3):1168-1175.

  • Pollen-induced oxidative DNA damage response regulates miRNAs controlling allergic inflammation. Aguilera-Aguirre L, Hao W, Pan L, Li X, Saavedra-Molina A, Bacsi A, Radak Z, Sur S, Brasier AR, Ba X, Boldogh I. Am J Physiol Lung Cell Mol Physiol. 2017 Dec 1;313(6):L1058-L1068.

  • miR-27b-3p, miR-181a-1-3p, and miR-326-5p are involved in the inhibition of macrophage activation in chronic liver injury. Li W, Chang N, Tian L, Yang J, Ji X, Xie J, Yang L, Li L. J Mol Med (Berl). 2017 Oct;95(10):1091-1105.


  • There are 79 references associated with mmu-mir-27b. Click here to see the complete list in PubMed.