Precursor miRNA: mmu-mir-215

Precursor miRNA

Precursor Name mmu-mir-215
Genomic Location chr1:185313581-185313692 (+); nearby genomic features
Clustered miRNAs mmu-mir-194-1,mmu-mir-215 (within 10kb in genome)
NCBI GENE ID 387211
miRBase ID MI0000974
Precursor Sequence 
agcucuc    ucaac  ug       gaa  a     -  uu        c     g
       agca     gg  uacagga   ug ccuau ga  ugacagac gugca c
       ||||     ||  |||||||   || ||||| ||  |||||||| ||||| 
       ucgu     cu  augucuu   ac ggaug cu  acugucug uaugu u
aaauuca    ---ca  gu       aua  c     u  -u        -     g

Mature miRNA

Mature Name mmu-miR-215-5p
Previous Name mmu-miR-215
Mature Sequence 5' - augaccuaugauuugacagac - 3' (length = 21)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000904
Similar miRNAs mmu-miR-192-5p (sharing the same seed sequence with mmu-miR-215-5p).

References

  • Epithelial miR-215 negatively modulates Th17-dominant inflammation by inhibiting CXCL12 production in the small intestine. Pareek S, Sanchenkova X, Sakaguchi T, Murakami M, Okumura R, Kayama H, Kawauchi S, Motooka D, Nakamura S, Okuzaki D, Kishimoto T, Takeda K. Genes Cells. 2022 Apr;27(4):243-253.

  • Melatonin: A regulator of the interplay between FoxO1, miR96, and miR215 signaling to diminish the growth, survival, and metastasis of murine adenocarcinoma. Oshiba RT, Touson E, Elsherbini YM, Abdraboh ME. Biofactors. 2021 Sep;47(5):740-753.

  • Exosomal miRNA-215-5p Derived from Adipose-Derived Stem Cells Attenuates Epithelial-Mesenchymal Transition of Podocytes by Inhibiting Jin J, Wang Y, Zhao L, Zou W, Tan M, He Q. Biomed Res Int. 2020 Feb 21;2020:2685305.

  • Upregulation of miR-215 exerts neuroprotection effects against ischemic injury via negative regulation of Act1/IL-17RA signaling. Sun H, Zhong D, Jin J, Liu Q, Wang H, Li G. Neurosci Lett. 2018 Jan 1;662:233-241.

  • Cluster microRNAs miR-194 and miR-215 suppress the tumorigenicity of intestinal tumor organoids. Nakaoka T, Saito Y, Shimamoto Y, Muramatsu T, Kimura M, Kanai Y, Saito H. Cancer Sci. 2017 Apr;108(4):678-684.

  • MicroRNA-215 impairs adipocyte differentiation and co-represses FNDC3B and CTNNBIP1. Peng Y, Li H, Li X, Yu S, Xiang H, Peng J, Jiang S. Int J Biochem Cell Biol. 2016 Oct;79:104-112.

  • MiR-215 Is Induced Post-transcriptionally via HIF-Drosha Complex and Mediates Glioma-Initiating Cell Adaptation to Hypoxia by Targeting KDM1B. Hu J, Sun T, Wang H, Chen Z, Wang S, Yuan L, Liu T, Li HR, Wang P, Feng Y, Wang Q, McLendon RE, Friedman AH, Keir ST, Bigner DD, Rathmell J, Fu XD, Li QJ, Wang H, Wang XF. Cancer Cell. 2016 Jan 11;29(1):49-60.

  • Functional implications of microRNA-215 in TGF-β1-induced phenotypic transition of mesangial cells by targeting CTNNBIP1. Mu J, Pang Q, Guo YH, Chen JG, Zeng W, Huang YJ, Zhang J, Feng B. PLoS One. 2013;8(3):e58622.

  • Impact of lactobacilli on orally acquired listeriosis. Archambaud C, Nahori MA, Soubigou G, Bécavin C, Laval L, Lechat P, Smokvina T, Langella P, Lecuit M, Cossart P. Proc Natl Acad Sci U S A. 2012 Oct 9;109(41):16684-9.

  • A high-resolution anatomical atlas of the transcriptome in the mouse embryo. Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, Magen A, Canidio E, Pagani M, Peluso I, Lin-Marq N, Koch M, Bilio M, Cantiello I, Verde R, De Masi C, Bianchi SA, Cicchini J, Perroud E, Mehmeti S, Dagand E, Schrinner S, Nürnberger A, Schmidt K, Metz K, Zwingmann C, Brieske N, Springer C, Hernandez AM, Herzog S, Grabbe F, Sieverding C, Fischer B, Schrader K, Brockmeyer M, Dettmer S, Helbig C, Alunni V, Battaini MA, Mura C, Henrichsen CN, Garcia-Lopez R, Echevarria D, Puelles E, Garcia-Calero E, Kruse S, Uhr M, Kauck C, Feng G, Milyaev N, Ong CK, Kumar L, Lam M, Semple CA, Gyenesei A, Mundlos S, Radelof U, Lehrach H, Sarmientos P, Reymond A, Davidson DR, Dollé P, Antonarakis SE, Yaspo ML, Martinez S, Baldock RA, Eichele G, Ballabio A. PLoS Biol. 2011 Jan 18;9(1):e1000582.

  • miRBase: integrating microRNA annotation and deep-sequencing data. Kozomara A, Griffiths-Jones S. Nucleic Acids Res. 2011 Jan;39(Database issue):D152-7.

  • Regulation of WNK1 expression by miR-192 and aldosterone. Elvira-Matelot E, Zhou XO, Farman N, Beaurain G, Henrion-Caude A, Hadchouel J, Jeunemaitre X. J Am Soc Nephrol. 2010 Oct;21(10):1724-31.

  • Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP. Genes Dev. 2010 May 15;24(10):992-1009.

  • E-cadherin expression is regulated by miR-192/215 by a mechanism that is independent of the profibrotic effects of transforming growth factor-beta. Wang B, Herman-Edelstein M, Koh P, Burns W, Jandeleit-Dahm K, Watson A, Saleem M, Goodall GJ, Twigg SM, Cooper ME, Kantharidis P. Diabetes. 2010 Jul;59(7):1794-802.

  • MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A. Mol Hum Reprod. 2010 Jul;16(7):463-71.

  • Maternal microRNAs are essential for mouse zygotic development. Tang F, Kaneda M, O'Carroll D, Hajkova P, Barton SC, Sun YA, Lee C, Tarakhovsky A, Lao K, Surani MA. Genes Dev. 2007 Mar 15;21(6):644-8.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.

  • In situ detection of miRNAs in animal embryos using LNA-modified oligonucleotide probes. Kloosterman WP, Wienholds E, de Bruijn E, Kauppinen S, Plasterk RH. Nat Methods. 2006 Jan;3(1):27-9.

  • Vertebrate microRNA genes. Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP. Science. 2003 Mar 7;299(5612):1540.

  • Numerous microRNPs in neuronal cells containing novel microRNAs. Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G. RNA. 2003 Feb;9(2):180-6.