Precursor miRNA: mmu-mir-200c

Precursor miRNA

Precursor Name mmu-mir-200c
Genomic Location chr6:124718322-124718390 (-); nearby genomic features
Clustered miRNAs mmu-mir-141,mmu-mir-200c (within 10kb in genome)
NCBI GENE ID 723944
miRBase ID MI0000694
Precursor Sequence 
  cu    -      a        u   u   gg
cc  cguc uuaccc gcaguguu ggg gcu  u
||  |||| |||||| |||||||| ||| |||   u
gg  guag aauggg cgucauaa cuc uga  g
  ag    u      c        u   -   gg

Mature miRNA

Mature Name mmu-miR-200c-3p
Previous Name mmu-miR-200c
Mature Sequence 5' - uaauacugccggguaaugaugga - 3' (length = 23)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000657
Similar miRNAs mmu-miR-200b-3p, mmu-miR-429-3p (sharing the same seed sequence with mmu-miR-200c-3p).

References

  • Sex-biased gene and microRNA expression in the developing mouse brain is associated with neurodevelopmental functions and neurological phenotypes. Szakats S, McAtamney A, Cross H, Wilson MJ. Biol Sex Differ. 2023 Sep 7;14(1):57.

  • Increased miR-200c levels disrupt palatal fusion by affecting apoptosis, cell proliferation, and cell migration. Won HJ, Won HS, Shin JO. Biochem Biophys Res Commun. 2023 Jul 5;664:43-49.

  • MicroRNA-200c-5p Regulates Migration and Differentiation of Myoblasts via Targeting Liu Y, Yao Y, Zhang Y, Yan C, Yang M, Wang Z, Li W, Li F, Wang W, Yang Y, Li X, Tang Z. Int J Mol Sci. 2023 Mar 5;24(5):4995.

  • Hyaluronan synthase 2, a target of miR-200c, promotes carbon tetrachloride-induced acute and chronic liver inflammation via regulation of CCL3 and CCL4. Kim SM, Song GY, Shim A, Lee JH, Eom CB, Liu C, Yang YM, Seki E. Exp Mol Med. 2022 Jun;54(6):739-752.

  • MicroRNA-200c coordinates HNF1 homeobox B and apolipoprotein O functions to modulate lipid homeostasis in alcoholic fatty liver disease. Mostofa MG, Tran M, Gilling S, Lee G, Fraher O, Jin L, Kang H, Park YK, Lee JY, Wang L, Shin DJ. J Biol Chem. 2022 Jun;298(6):101966.

  • MicroRNA-200c-5p targets NIMA Related Kinase 7 (NEK7) to inhibit NOD-like receptor 3 (NLRP3) inflammasome activation, MODE-K cell pyroptosis, and inflammatory bowel disease in mice. Wu G, Zhang D, Yang L, Wu Q, Yuan L. Mol Immunol. 2022 Jun;146:57-68.

  • miR-200c suppression increases tau hyperphosphorylation by targeting 14-3-3γ in early stage of 5xFAD mouse model of Alzheimer's disease. Park H, Lee YB, Chang KA. Int J Biol Sci. 2022 Mar 6;18(5):2220-2234.

  • Necdin, one of the important pathway proteins in the regulation of osteosarcoma progression by microRNA-200c. Li J, Wu Z, Wang J, Wu T, Shen Z, Zhang L, Lv J, Bai J, Feng Y. Bioengineered. 2022 Apr;13(4):8915-8925.

  • MiR-200c-3p Regulates DUSP1/MAPK Pathway in the Nonalcoholic Fatty Liver After Laparoscopic Sleeve Gastrectomy. Zhang TT, Wang Y, Zhang XW, Yang KY, Miao XQ, Zhao GH. Front Endocrinol (Lausanne). 2022 Mar 1;13:792439.

  • Intercellular transfer of miR-200c-3p impairs the angiogenic capacity of cardiac endothelial cells. Ottaviani L, Juni RP, de Abreu RC, Sansonetti M, Sampaio-Pinto V, Halkein J, Hegenbarth JC, Ring N, Knoops K, Kocken JMM, Jesus C, Ernault AC, El Azzouzi H, Rühle F, Olieslagers S, Fernandes H, Ferreira L, Braga L, Stoll M, Nascimento DS, de Windt LJ, da Costa Martins PA. Mol Ther. 2022 Jun 1;30(6):2257-2273.

  • MiR-200c-3p targets SESN1 and represses the IL-6/AKT loop to prevent cholangiocyte activation and cholestatic liver fibrosis. Song Y, Tran M, Wang L, Shin DJ, Wu J. Lab Invest. 2022 May;102(5):485-493.

  • MicroRNA-200c/429 mediated regulation of Zeb1 augments N-Cadherin in mouse cardiac mesenchymal cells. Nath AV, Ajit S, Sekar AJ, P R AK, Muthusamy S. Cell Biol Int. 2022 Feb;46(2):222-233.

  • Ectopic activation of the miR-200c-EpCAM axis enhances antitumor T cell responses in models of adoptive cell therapy. Zhang M, Zhao Z, Pritykin Y, Hannum M, Scott AC, Kuo F, Sanghvi V, Chan TA, Seshan V, Wendel HG, Schietinger A, Sadelain M, Huse M. Sci Transl Med. 2021 Sep 15;13(611):eabg4328.

  • Expression of miR-200c corresponds with increased reactive oxygen species and hypoxia markers after transient focal ischemia in mice. Arvola O, Griffiths B, Rao A, Xu L, Pastroudis IA, Stary CM. Neurochem Int. 2021 Oct;149:105146.

  • miR-200 Xue B, Chuang CH, Prosser HM, Fuziwara CS, Chan C, Sahasrabudhe N, Kühn M, Wu Y, Chen J, Biton A, Chen C, Wilkinson JE, McManus MT, Bradley A, Winslow MM, Su B, He L. Genes Dev. 2021 Aug 1;35(15-16):1109-1122.

  • Maternal diabetes induces senescence and neural tube defects sensitive to the senomorphic rapamycin. Xu C, Shen WB, Reece EA, Hasuwa H, Harman C, Kaushal S, Yang P. Sci Adv. 2021 Jun 30;7(27):eabf5089.

  • The miR-200-Zeb1 axis regulates key aspects of β-cell function and survival in vivo. Title AC, Silva PN, Godbersen S, Hasenöhrl L, Stoffel M. Mol Metab. 2021 Nov;53:101267.

  • miR-200c-3p Regulates Epitelial-to-Mesenchymal Transition in Epicardial Mesothelial Cells by Targeting Epicardial Follistatin-Related Protein 1. Pontemezzo E, Foglio E, Vernucci E, Magenta A, D'Agostino M, Sileno S, Astanina E, Bussolino F, Pellegrini L, Germani A, Russo MA, Limana F. Int J Mol Sci. 2021 May 7;22(9):4971.

  • The miR-200 family is required for ectodermal organ development through the regulation of the epithelial stem cell niche. Sweat M, Sweat Y, Yu W, Su D, Leonard RJ, Eliason SL, Amendt BA. Stem Cells. 2021 Jun;39(6):761-775.

  • MicroRNA-200b/c-3p regulate epithelial plasticity and inhibit cutaneous wound healing by modulating TGF-β-mediated RAC1 signaling. Tang H, Wang X, Zhang M, Yan Y, Huang S, Ji J, Xu J, Zhang Y, Cai Y, Yang B, Lan W, Huang M, Zhang L. Cell Death Dis. 2020 Oct 29;11(10):931.

    • There are 80 references associated with mmu-mir-200c. Click here to see the complete list in PubMed.