Precursor miRNA: mmu-mir-133b



Precursor miRNA

Precursor Name mmu-mir-133b
Genomic Location chr1:20682769-20682887 (+); nearby genomic features
Clustered miRNAs mmu-mir-206,mmu-mir-133b (within 10kb in genome)
NCBI GENE ID 723817
miRBase ID MI0000821
Precursor Sequence
c       --gg    --g   --       c        ca  c  a      u  g    
 cuccaaa    gagu   gcc  cccugcu uggcuggu  aa gg accaag cc ucuuc
 |||||||    ||||   |||  ||||||| ||||||||  || || |||||| || |||| c
 gagguuu    cucg   cgg  gggacga aucgacca  uu cc ugguuu gg agagu
a       auaa    aaa   uc       c        ac  c  c      -  -    

Mature miRNA

Mature Name mmu-miR-133b-3p
Previous Name mmu-miR-133b
Mature Sequence 5' - uuugguccccuucaaccagcua - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000769
Similar miRNAs mmu-miR-133a-3p, mmu-miR-133c (sharing the same seed sequence with mmu-miR-133b-3p).

References


  • Interindividual Variation in Gut Nitrergic Neuron Density Is Regulated By GDNF Levels and ETV1. Virtanen HT, Choopanian P, Porokuokka LL, Forsgård R, Garton DR, Olfat S, Korpela R, Mirzaie M, Andressoo JO. Cell Mol Gastroenterol Hepatol. 2024;18(6):101405.

  • MBNL splicing factors regulate the microtranscriptome of skeletal muscles. Piasecka A, SzczeÅ›niak MW, Sekrecki M, Kajdasz A, Sznajder ŁJ, Baud A, Sobczak K. Nucleic Acids Res. 2024 Oct 28;52(19):12055-12073.

  • Forkhead box L2 is a target of miR-133b and plays an important role in the pathogenesis of non-small cell lung cancer. Li J, Gao L, Wang A, Qian H, Zhu J, Ji S, Chen J, Liu Z, Ji C. Cancer Med. 2023 Apr;12(8):9826-9842.

  • Contribution of skeletal muscle-specific microRNA-133b to insulin resistance in heart failure. Velasquez FC, Roman B, Hernández-Ochoa EO, Leppo MK, Truong SK, Steenbergen C, Schneider MF, Weiss RG, Das S. Am J Physiol Heart Circ Physiol. 2023 May 1;324(5):H598-H609.

  • MicroRNA profiling reveals the role of miR-133b-3p in promoting apoptosis and inhibiting cell proliferation and testosterone synthesis in mouse TM3 cells. Pan C, Fei Q, Jin J, Zheng J, Wu D, Li H, Huang X, Kong X. In Vitro Cell Dev Biol Anim. 2023 Jan;59(1):63-75.

  • Smad8 Is Increased in Duchenne Muscular Dystrophy and Suppresses miR-1, miR-133a, and miR-133b. Lopez MA, Si Y, Hu X, Williams V, Qushair F, Carlyle J, Alesce L, Conklin M, Gilbert S, Bamman MM, Alexander MS, King PH. Int J Mol Sci. 2022 Jul 7;23(14):7515.

  • Exosomal microRNA-133b-3p from bone marrow mesenchymal stem cells inhibits angiogenesis and oxidative stress via FBN1 repression in diabetic retinopathy. Liang G, Qin Z, Luo Y, Yin J, Shi Z, Wei R, Ma W. Gene Ther. 2022 Dec;29(12):710-719.

  • Acetoacetate promotes muscle cell proliferation via the miR-133b/SRF axis through the Mek-Erk-MEF2 pathway. Zhong R, Miao R, Meng J, Wu R, Zhang Y, Zhu D. Acta Biochim Biophys Sin (Shanghai). 2021 Jul 28;53(8):1009-1016.

  • MicroRNA‑133b alleviates doxorubicin‑induced cardiomyocyte apoptosis and cardiac fibrosis by targeting PTBP1 and TAGLN2. Li Z, Ye Z, Ma J, Gu Q, Teng J, Gong X. Int J Mol Med. 2021 Jul;48(1):125.

  • Regulation of connective tissue growth factor expression by miR-133b for the treatment of renal interstitial fibrosis in aged mice with unilateral ureteral obstruction. Cao D, Wang Y, Zhang Y, Zhang Y, Huang Q, Yin Z, Cai G, Chen X, Sun X. Stem Cell Res Ther. 2021 Mar 10;12(1):171.

  • Downregulation of circular RNA HECTD1 induces neuroprotection against ischemic stroke through the microRNA-133b/TRAF3 pathway. Dai Q, Ma Y, Xu Z, Zhang L, Yang H, Liu Q, Wang J. Life Sci. 2021 Jan 1;264:118626.

  • The microRNA miR-133b functions to slow Duchenne muscular dystrophy pathogenesis. Taetzsch T, Shapiro D, Eldosougi R, Myers T, Settlage RE, Valdez G. J Physiol. 2021 Jan;599(1):171-192.

  • MicroRNA‑133b aggravates atherosclerosis by activating the Notch signaling pathway. Han B, Li T, Zheng S. Mol Med Rep. 2020 Aug;22(2):1621-1630.

  • Activation of CB2R with AM1241 ameliorates neurodegeneration via the Xist/miR-133b-3p/Pitx3 axis. He X, Yang L, Huang R, Lin L, Shen Y, Cheng L, Jin L, Wang S, Zhu R. J Cell Physiol. 2020 Sep;235(9):6032-6042.

  • Dopaminergic neuron injury in Parkinson's disease is mitigated by interfering lncRNA SNHG14 expression to regulate the miR-133b/ α-synuclein pathway. Zhang LM, Wang MH, Yang HC, Tian T, Sun GF, Ji YF, Hu WT, Liu X, Wang JP, Lu H. Aging (Albany NY). 2019 Nov 4;11(21):9264-9279.

  • Wnt/β-catenin signaling induces the myomiRs miR-133b and miR-206 to suppress Pax7 and induce the myogenic differentiation program. Cui S, Li L, Mubarokah SN, Meech R. J Cell Biochem. 2019 Aug;120(8):12740-12751.

  • Premature MicroRNA-1 Expression Causes Hypoplasia of the Cardiac Ventricular Conduction System. Samal E, Evangelista M, Galang G, Srivastava D, Zhao Y, Vedantham V. Front Physiol. 2019 Mar 18;10:235.

  • Kir6.2 Deficiency Promotes Mesencephalic Neural Precursor Cell Differentiation via Regulating miR-133b/GDNF in a Parkinson's Disease Mouse Model. Zhou Y, Zhu J, Lv Y, Song C, Ding J, Xiao M, Lu M, Hu G. Mol Neurobiol. 2018 Nov;55(11):8550-8562.

  • MicroRNA-133b Ameliorates Allergic Inflammation and Symptom in Murine Model of Allergic Rhinitis by Targeting Nlrp3. Xiao L, Jiang L, Hu Q, Li Y. Cell Physiol Biochem. 2017;42(3):901-912.

  • Deregulated Cardiac Specific MicroRNAs in Postnatal Heart Growth. Yu P, Wang H, Xie Y, Zhou J, Yao J, Che L. Biomed Res Int. 2016;2016:6241763.


  • There are 56 references associated with mmu-mir-133b. Click here to see the complete list in PubMed.