Precursor miRNA: mmu-mir-127

Precursor miRNA

Precursor Name mmu-mir-127
Genomic Location chr12:109592846-109592915 (+); nearby genomic features
Clustered miRNAs mmu-mir-337,mmu-mir-3544,mmu-mir-540,mmu-mir-665,mmu-mir-3070-1,mmu-mir-3070-2,mmu-mir-431,mmu-mir-433,mmu-mir-127,mmu-mir-434,mmu-mir-432,mmu-mir-3071,mmu-mir-136 (within 10kb in genome)
NCBI GENE ID 387146
miRBase ID MI0000154
Precursor Sequence 
----      ugcug         g  c      --  a
    ccagcc     aagcucaga gg ucugau  uc g
    ||||||     ||||||||| || ||||||  ||  a
    ggucgg     uucgagucu cc aggcua  ag a
ggcu      -----         g  u      cu  a

Mature miRNA

Mature Name mmu-miR-127-5p
Previous Name mmu-miR-127*
Mature Sequence 5' - cugaagcucagagggcucugau - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0004530

Mature miRNA

Mature Name mmu-miR-127-3p
Previous Name mmu-miR-127
Mature Sequence 5' - ucggauccgucugagcuuggcu - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000139

References

  • Silencing of maternally expressed RNAs in Dlk1-Dio3 domain causes fatal vascular injury in the fetal liver. Yu H, Zhao Y, Cheng R, Wang M, Hu X, Zhang X, Teng X, He H, Han Z, Han X, Wang Z, Liu B, Zhang Y, Wu Q. Cell Mol Life Sci. 2024 Oct 9;81(1):429.

  • LncRNAs in the Teng X, He H, Yu H, Zhang X, Xing J, Shen J, Li C, Wang M, Shao L, Wang Z, Yang H, Zhang Y, Wu Q. Int J Mol Sci. 2024 Jul 26;25(15):8184.

  • MiR-127-3p enhances macrophagic proliferation via disturbing fatty acid profiles and oxidative phosphorylation in atherosclerosis. Liu Y, Wu Y, Wang C, Hu W, Zou S, Ren H, Zuo Y, Qu L. J Mol Cell Cardiol. 2024 Aug;193:36-52.

  • Maternal RNA transcription in Dlk1-Dio3 domain is critical for proper development of the mouse placental vasculature. Zhang X, He H, Yu H, Teng X, Wang Z, Li C, Li J, Yang H, Shen J, Wu T, Zhang F, Zhang Y, Wu Q. Commun Biol. 2024 Mar 23;7(1):363.

  • miR-127-3p Is an Epigenetic Activator of Myofibroblast Senescence Situated within the MicroRNA-Enriched Dlk1-Dio3‒Imprinted Domain on Mouse Chromosome 12. Auler M, Bergmeier V, Georgieva VS, Pitzler L, Frie C, Nüchel J, Eckes B, Hinz B, Brachvogel B. J Invest Dermatol. 2021 Apr;141(4S):1076-1086.e3.

  • MicroRNA-127-3p regulates myoblast proliferation by targeting Sept7. Li J, Wang G, Jiang J, Zhang L, Zhou P, Ren H. Biotechnol Lett. 2020 Sep;42(9):1633-1644.

  • The mammalian LINC complex component SUN1 regulates muscle regeneration by modulating drosha activity. Loo TH, Ye X, Chai RJ, Ito M, Bonne G, Ferguson-Smith AC, Stewart CL. Elife. 2019 Nov 5;8:e49485.

  • Meg3-DMR, not the Meg3 gene, regulates imprinting of the Dlk1-Dio3 locus. Zhu W, Botticelli EM, Kery RE, Mao Y, Wang X, Yang A, Wang X, Zhou J, Zhang X, Soberman RJ, Klibanski A, Zhou Y. Dev Biol. 2019 Nov 1;455(1):10-18.

  • MicroRNA-127-3p controls murine hematopoietic stem cell maintenance by limiting differentiation. Crisafulli L, Muggeo S, Uva P, Wang Y, Iwasaki M, Locatelli S, Anselmo A, Colombo FS, Carlo-Stella C, Cleary ML, Villa A, Gentner B, Ficara F. Haematologica. 2019 Sep;104(9):1744-1755.

  • mir-127-3p inhibits the proliferation of myocytes by targeting KMT5a. Yuan R, Zhang X, Fang Y, Nie Y, Cai S, Chen Y, Mo D. Biochem Biophys Res Commun. 2018 Sep 5;503(2):970-976.

  • Maternally expressed miR-379/miR-544 cluster is dispensable for testicular development and spermatogenesis in mice. Cao C, Wen Y, Dong J, Wang X, Qin W, Huang X, Yuan S. Mol Reprod Dev. 2018 Mar;85(3):175-177.

  • Overexpression of microRNAs from the Gtl2-Rian locus contributes to postnatal death in mice. Kumamoto S, Takahashi N, Nomura K, Fujiwara M, Kijioka M, Uno Y, Matsuda Y, Sotomaru Y, Kono T. Hum Mol Genet. 2017 Oct 1;26(19):3653-3662.

  • miR-127 contributes to ventilator-induced lung injury. Li Q, Ge YL, Li M, Fang XZ, Yuan YP, Liang L, Huang SQ. Mol Med Rep. 2017 Oct;16(4):4119-4126.

  • miR-127 enhances myogenic cell differentiation by targeting S1PR3. Zhai L, Wu R, Han W, Zhang Y, Zhu D. Cell Death Dis. 2017 Mar 30;8(3):e2707.

  • MicroRNA-101 Regulates Multiple Developmental Programs to Constrain Excitation in Adult Neural Networks. Lippi G, Fernandes CC, Ewell LA, John D, Romoli B, Curia G, Taylor SR, Frady EP, Jensen AB, Liu JC, Chaabane MM, Belal C, Nathanson JL, Zoli M, Leutgeb JK, Biagini G, Yeo GW, Berg DK. Neuron. 2016 Dec 21;92(6):1337-1351.

  • MicroRNA-127 Promotes Mesendoderm Differentiation of Mouse Embryonic Stem Cells by Targeting Left-Right Determination Factor 2. Ma H, Lin Y, Zhao ZA, Lu X, Yu Y, Zhang X, Wang Q, Li L. J Biol Chem. 2016 Jun 3;291(23):12126-35.

  • A trans-homologue interaction between reciprocally imprinted miR-127 and Rtl1 regulates placenta development. Ito M, Sferruzzi-Perri AN, Edwards CA, Adalsteinsson BT, Allen SE, Loo TH, Kitazawa M, Kaneko-Ishino T, Ishino F, Stewart CL, Ferguson-Smith AC. Development. 2015 Jul 15;142(14):2425-30.

  • Deregulation of MiR-34b/Sox2 Predicts Prostate Cancer Progression. Forno I, Ferrero S, Russo MV, Gazzano G, Giangiobbe S, Montanari E, Del Nero A, Rocco B, Albo G, Languino LR, Altieri DC, Vaira V, Bosari S. PLoS One. 2015 Jun 24;10(6):e0130060.

  • miR-26a and miR-384-5p are required for LTP maintenance and spine enlargement. Gu QH, Yu D, Hu Z, Liu X, Yang Y, Luo Y, Zhu J, Li Z. Nat Commun. 2015 Apr 10;6:6789.

  • MiR-127 modulates macrophage polarization and promotes lung inflammation and injury by activating the JNK pathway. Ying H, Kang Y, Zhang H, Zhao D, Xia J, Lu Z, Wang H, Xu F, Shi L. J Immunol. 2015 Feb 1;194(3):1239-51.

    • There are 51 references associated with mmu-mir-127. Click here to see the complete list in PubMed.