Precursor miRNA: mmu-let-7e

Precursor miRNA

Precursor Name mmu-let-7e
Genomic Location chr17:17830352-17830444 (+); nearby genomic features
Clustered miRNAs mmu-mir-99b,mmu-let-7e,mmu-mir-125a (within 10kb in genome)
NCBI GENE ID 387248
miRBase ID MI0000561
Precursor Sequence 
c    cc  c   cu   g                u  ggaaga ac
 gcgc  cc ggg  gag uaggagguuguauagu ga      c  c
 ||||  || |||  ||| |||||||||||||||| ||      |  
 cgcg  gg ccc  uuc auccuccggcauauca cu      g  c
c    uc  a   cu   g                -  --agag ag

Mature miRNA

Mature Name mmu-let-7e-5p
Previous Name mmu-let-7e
Mature Sequence 5' - ugagguaggagguuguauaguu - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000524
Similar miRNAs mmu-let-7a-5p, mmu-let-7b-5p, mmu-let-7c-5p, mmu-let-7d-5p, mmu-let-7f-5p, mmu-let-7g-5p, mmu-let-7i-5p, mmu-let-7k, mmu-miR-1961, mmu-miR-98-5p (sharing the same seed sequence with mmu-let-7e-5p).

References

  • Growth-suppressor microRNAs mediate synaptic overgrowth and behavioral deficits in Fragile X mental retardation protein deficiency. Subramanian M, Mills WT 4th, Paranjpe MD, Onuchukwu US, Inamdar M, Maytin AR, Li X, Pomerantz JL, Meffert MK. iScience. 2023 Dec 12;27(1):108676.

  • Expression of microRNA let-7 in cleavage embryos modulates cell fate determination and formation of mouse blastocysts†. Liu W, Chen J, Yang C, Lee KF, Lee YL, Chiu PC, Zhang Y, Duan YG, Liu K, Yeung WS. Biol Reprod. 2022 Dec 10;107(6):1452-1463.

  • c-MAF coordinates enterocyte zonation and nutrient uptake transcriptional programs. González-Loyola A, Bernier-Latmani J, Roci I, Wyss T, Langer J, Durot S, Munoz O, Prat-Luri B, Delorenzi M, Lutolf MP, Zamboni N, Verdeil G, Petrova TV. J Exp Med. 2022 Dec 5;219(12):e20212418.

  • Astrocytic IGF-1 and IGF-1R Orchestrate Mitophagy in Traumatic Brain Injury via Exosomal miR-let-7e. Dabin R, Wei C, Liang S, Ke C, Zhihan W, Ping Z. Oxid Med Cell Longev. 2022 Aug 24;2022:3504279.

  • Let-7e-5p Regulates IGF2BP2, and Induces Muscle Atrophy. Okamura T, Okada H, Hashimoto Y, Majima S, Senmaru T, Nakanishi N, Asano M, Yamazaki M, Hamaguchi M, Fukui M. Front Endocrinol (Lausanne). 2021 Dec 24;12:791363.

  • Lin28 paralogs regulate lung branching morphogenesis. Osborne JK, Kinney MA, Han A, Akinnola KE, Yermalovich AV, Vo LT, Pearson DS, Sousa PM, Ratanasirintrawoot S, Tsanov KM, Barragan J, North TE, Metzger RJ, Daley GQ. Cell Rep. 2021 Jul 20;36(3):109408.

  • let-7e downregulation characterizes early phase colonic adenoma in APCMin/+ mice and human FAP subjects. Contursi A, Arconzo M, Cariello M, Piglionica M, D'Amore S, Vacca M, Graziano G, Gadaleta RM, Valanzano R, Mariani-Costantini R, Villani G, Moschetta A, Piccinin E. PLoS One. 2021 Apr 26;16(4):e0249238.

  • CCR7 and its related molecules may be potential biomarkers of pulmonary arterial hypertension. Cai M, Li X, Dong H, Wang Y, Huang X. FEBS Open Bio. 2021 Jun;11(6):1565-1578.

  • Let-7e-5p Regulates GLP-1 Content and Basal Release From Enteroendocrine L Cells From DIO Male Mice. Handgraaf S, Dusaulcy R, Visentin F, Philippe J, Gosmain Y. Endocrinology. 2020 Feb 1;161(2):bqz037.

  • Differentially expressed microRNA profiles in exosomes from vascular smooth muscle cells associated with coronary artery calcification. Pan W, Liang J, Tang H, Fang X, Wang F, Ding Y, Huang H, Zhang H. Int J Biochem Cell Biol. 2020 Jan;118:105645.

  • Developmental conservation of microRNA gene localization at the nuclear periphery. Salataj E, Stathopoulou C, Hafþórsson RA, Nikolaou C, Spilianakis CG. PLoS One. 2019 Nov 4;14(11):e0223759.

  • Lin28 and let-7 regulate the timing of cessation of murine nephrogenesis. Yermalovich AV, Osborne JK, Sousa P, Han A, Kinney MA, Chen MJ, Robinton DA, Montie H, Pearson DS, Wilson SB, Combes AN, Little MH, Daley GQ. Nat Commun. 2019 Jan 11;10(1):168.

  • Toll-Like Receptor and miRNA-let-7e Expression Alter the Inflammatory Response in Muxel SM, Acuña SM, Aoki JI, Zampieri RA, Floeter-Winter LM. Front Immunol. 2018 Nov 29;9:2792.

  • MiR-let-7e inhibits invasion and magration and regulates HMGB1 expression in papillary thyroid carcinoma. Ding C, Yu H, Shi C, Shi T, Qin H, Cui Y. Biomed Pharmacother. 2019 Feb;110:528-536.

  • MK2 mediates macrophage activation and acute lung injury by regulating let-7e miRNA. Wu Y, He H, Ding Y, Liu S, Zhang D, Wang J, Jiang H, Zhang D, Sun L, Ye RD, Qian F. Am J Physiol Lung Cell Mol Physiol. 2018 Sep 1;315(3):L371-L381.

  • Putative binding sites for mir-125 family miRNAs in the mouse Lfng 3'UTR affect transcript expression in the segmentation clock, but mir-125a-5p is dispensable for normal somitogenesis. Wahi K, Friesen S, Coppola V, Cole SE. Dev Dyn. 2017 Oct;246(10):740-748.

  • Let-7 Shilo V, Mor-Yosef Levi I, Abel R, Mihailović A, Wasserman G, Naveh-Many T, Ben-Dov IZ. J Am Soc Nephrol. 2017 Aug;28(8):2353-2363.

  • Rewiring of embryonic glucose metabolism via suppression of PFK-1 and aldolase during mouse chorioallantoic branching. Miyazawa H, Yamaguchi Y, Sugiura Y, Honda K, Kondo K, Matsuda F, Yamamoto T, Suematsu M, Miura M. Development. 2017 Jan 1;144(1):63-73.

  • The RNA-binding protein LIN28B regulates developmental timing in the mammalian cochlea. Golden EJ, Benito-Gonzalez A, Doetzlhofer A. Proc Natl Acad Sci U S A. 2015 Jul 21;112(29):E3864-73.

  • Deregulation of MiR-34b/Sox2 Predicts Prostate Cancer Progression. Forno I, Ferrero S, Russo MV, Gazzano G, Giangiobbe S, Montanari E, Del Nero A, Rocco B, Albo G, Languino LR, Altieri DC, Vaira V, Bosari S. PLoS One. 2015 Jun 24;10(6):e0130060.

    • There are 48 references associated with mmu-let-7e. Click here to see the complete list in PubMed.