Precursor miRNA: hsa-mir-542

Precursor miRNA

Precursor Name hsa-mir-542
Genomic Location chrX:134541341-134541437 (-); nearby genomic features
Clustered miRNAs hsa-mir-450b,hsa-mir-450a-1,hsa-mir-450a-2,hsa-mir-542,hsa-mir-503,hsa-mir-424 (within 10kb in genome)
NCBI GENE ID 664617
miRBase ID MI0003686
Precursor Sequence 
----------caga        auc    gg    uca         -a   c
              ucucagac   ucgg  auca   ugucacgag  uac a
              ||||||||   ||||  ||||   |||||||||  ||| 
              agggucug   aguc  uagu   acaguguuc  gug g
acuucuacucaccg        gaa    aa    uag         ac   u

Mature miRNA

Mature Name hsa-miR-542-5p
Mature Sequence 5' - ucggggaucaucaugucacgaga - 3' (length = 23)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0003340

Mature miRNA

Mature Name hsa-miR-542-3p
Mature Sequence 5' - ugugacagauugauaacugaaa - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0003389

References

  • Lnc‑RGS5 sponges miR‑542‑5p to promote FoxM1/VEGFA signaling and breast cancer cell proliferation. Song J, Tang Y, Song F. Int J Oncol. 2023 Oct;63(4):111.

  • Downregulation of LINC00221 promotes angiopoiesis in HUVEC and inhibits recruitment of macrophages by augmenting miR-542-3p in trophoblast cells. Zhao G, Wang Y, Wang Y, Cui X, Liu L, Zhi Y, Han X, Zhao L, Chen J, Shi Z, Cui S. J Assist Reprod Genet. 2022 Oct;39(10):2381-2393.

  • Overexpression of VPS11 antagonizes the promoting effect of miR-542-3p on Mycobacterium tuberculosis survival in macrophages by regulating autophagy. Luo D, Wu J, Liu Y, Li P, Liang X, Xiao S, Qi Z, Liu T, Pan J. Microb Pathog. 2022 Aug;169:105609.

  • Circular RNA circ_0000515 adsorbs miR-542-3p to accelerate bladder cancer progression via up-regulating ILK expression. Peng G, Guan J, Leng P, Peng L, Cao M, Feng Y. Aging (Albany NY). 2022 Jan 14;14(1):430-442.

  • circRNA RPPH1 Facilitates the Aggravation of Breast Cancer Development by Regulating miR-542-3p/ARHGAP1 Pathway. Qi L, Sun B, Yang B, Lu S. Cancer Biother Radiopharm. 2022 Oct;37(8):708-719.

  • The life in a gradient: calcium, the lncRNA SPRR2C and mir542/mir196a meet in the epidermis to regulate the aging process. Breunig S, Wallner V, Kobler K, Wimmer H, Steinbacher P, Streubel MK, Bischof J, Duschl J, Neuhofer C, Gruber W, Aberger F, Breitenbach M, Russe E, Wechselberger G, Duranton A, Richter K, Rinnerthaler M. Aging (Albany NY). 2021 Aug 2;13(15):19127-19144.

  • miR-542-3p Contributes to the HK2-Mediated High Glycolytic Phenotype in Human Glioma Cells. Kim J, Park MW, Park YJ, Ahn JW, Sim JM, Kim S, Heo J, Jeong JH, Lee M, Lim J, Moon JS. Genes (Basel). 2021 Apr 23;12(5):633.

  • Micro-RNA miR-542-3p suppresses decidualization by targeting ILK pathways in human endometrial stromal cells. Qu X, Fang Y, Zhuang S, Zhang Y. Sci Rep. 2021 Mar 30;11(1):7186.

  • Circulatory miR-221 & miR-542 expression profiles as potential molecular biomarkers in Hepatitis C Virus mediated liver cirrhosis and hepatocellular carcinoma. Yasser MB, Abdellatif M, Emad E, Jafer A, Ahmed S, Nageb L, Abdelshafy H, Al-Anany AM, Al-Arab MAE, Gibriel AA. Virus Res. 2021 Apr 15;296:198341.

  • Hypoxia/reoxygenation-induced upregulation of miRNA-542-5p aggravated cardiomyocyte injury by repressing autophagy. Wang F, Min X, Hu SY, You DL, Jiang TT, Wang L, Wu X. Hum Cell. 2021 Mar;34(2):349-359.

  • miR-542 inhibits tumorigenesis and chemoresistance through the AKT/NFκB pathway in cervical cancer. Liu QH, Li HL, Zhang H, Li Z, Zhao M, Zhang TT. J Biol Regul Homeost Agents. 2020 Sep-Oct;34(5):1809-1817.

  • Astrocyte elevated gene-1 serves as a target of miR542 to promote glioblastoma proliferation and invasion. Li C, Liu HL, Zhou YM, Shi YC, Zhang ZB, Chen L, Feng SY. Chin Med J (Engl). 2020 Oct 20;133(20):2437-2443.

  • MiR-542-5p regulates the progression of diabetic retinopathy by targeting CARM1. Guo N, Nulahou A, Bu Q, Liu M, Wang Y, Zhao Y, Yang L, Gao Y. Acta Biochim Pol. 2020 Sep 1;67(3):373-378.

  • Long noncoding RNA LINC00963 induces NOP2 expression by sponging tumor suppressor miR-542-3p to promote metastasis in prostate cancer. Sun F, Wu K, Yao Z, Mu X, Zheng Z, Sun M, Wang Y, Liu Z, Zhu Y. Aging (Albany NY). 2020 Jun 17;12(12):11500-11516.

  • MiR-542-3p drives renal fibrosis by targeting AGO1 in vivo and in vitro. Li J, Bao H, Zhang K, Yang X, Liu X, Li P, Li Q, Chen W. Life Sci. 2020 Aug 15;255:117845.

  • Long noncoding RNA SNHG8 promotes the proliferation of osteosarcoma cells by downregulating miR-542-3p. Zhong GB, Jiang CQ, Yu XS, Liu ZD, Wang WL, Xu RD. J Biol Regul Homeost Agents. 2020 Mar-Apr;34(2):517-524.

  • Role of miRNA-542-5p in the tumorigenesis of osteosarcoma. Zhu T, Fan D, Ye K, Liu B, Cui Z, Liu Z, Tian Y. FEBS Open Bio. 2020 Apr;10(4):627-636.

  • MicroRNA‑542‑3p represses OTUB1 expression to inhibit migration and invasion of esophageal cancer cells. Sun J, Deng Y, Shi J, Yang W. Mol Med Rep. 2020 Jan;21(1):35-42.

  • Long non-coding RNA CASC15 favors tumorigenesis and development of ovarian cancer via sponging miR-542-3p. Li Q, Liu W, Li S, Zhang S. Panminerva Med. 2021 Jun;63(2):245-246.

  • Downregulation of miR-542-3p Contributes to Apoptosis Resistance in Dermal Fibroblasts from Systemic Sclerosis Patients via Survivin Overexpression. Vahidi Manesh P, Farazmand A, Gharibdoost F, Vanaki N, Mostafaei S, Kavosi H, Mahmoudi MB, Mahmoudi M. Iran J Allergy Asthma Immunol. 2019 Apr 1;18(2):173-181.

    • There are 58 references associated with hsa-mir-542. Click here to see the complete list in PubMed.