Precursor miRNA: hsa-mir-522

Precursor miRNA

Precursor Name hsa-mir-522
Genomic Location chr19:53751211-53751297 (+); nearby genomic features
Clustered miRNAs hsa-mir-517c,hsa-mir-520h,hsa-mir-521-1,hsa-mir-522,hsa-mir-519a-1,hsa-mir-527,hsa-mir-516a-1,hsa-mir-1283-2,hsa-mir-516a-2 (within 10kb in genome)
NCBI GENE ID 574495
miRBase ID MI0003177
Precursor Sequence 
      -  u   u c            g  c     guug  u
ucucag gc gug c cucuagagggaa cg uuucu    uc g
|||||| || ||| | |||||||||||| || |||||    ||  a
agaguu cg cau g gagauuucccuu gu aaaga    ag a
      u  -   u u            g  a     --aa  a

Mature miRNA

Mature Name hsa-miR-522-5p
Previous Name hsa-miR-522*
Mature Sequence 5' - cucuagagggaagcgcuuucug - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0005451
Similar miRNAs hsa-miR-518d-5p, hsa-miR-518e-5p, hsa-miR-518f-5p, hsa-miR-519a-5p, hsa-miR-519b-5p, hsa-miR-519c-5p, hsa-miR-520c-5p, hsa-miR-523-5p, hsa-miR-526a-5p (sharing the same seed sequence with hsa-miR-522-5p).

References

  • Long non‑coding RNA LINC00238 suppresses the malignant phenotype of liver cancer by sponging miR‑522. Qian HG, Wu Q, Wu JH, Tian XY, Xu W, Hao CY. Mol Med Rep. 2022 Feb;25(2):71.

  • LncRNA DHRS4-AS1 ameliorates hepatocellular carcinoma by suppressing proliferation and promoting apoptosis via miR-522-3p/SOCS5 axis. Zhou Y, Li K, Zou X, Hua Z, Wang H, Bian W, Wang H, Chen F, Dai T. Bioengineered. 2021 Dec;12(2):10862-10877.

  • rs6426881 in the 3'-UTR of PBX1 is involved in breast and gastric cancers via altering the binding potential of miR-522-3p. Mohammadi M, Salehzadeh A, Talesh Sasani S, Tarang A. Mol Biol Rep. 2021 Nov;48(11):7405-7414.

  • miR-522 regulates cell proliferation, migration, invasion capacities and acts as a potential biomarker to predict prognosis in triple-negative breast cancer. Wang W, Zhang W, Wu J, Zhou Z, Ma J. Clin Exp Med. 2022 Aug;22(3):385-392.

  • MicroRNA-522-3p plays an oncogenic role in glioblastoma through activating Wnt/β-catenin signaling pathway via targeting SFRP2. Zhang L, Zhang P, Tan Y, Feng Q, Zhao R. Neuroreport. 2021 Jan 13;32(2):88-98.

  • Targeting of ΔNp63α by miR-522 promotes the migration of breast epithelial cells. Dong Y, Long J, Luo X, Xie G, Xiao ZJ, Tong Y. FEBS Open Bio. 2021 Feb;11(2):468-481.

  • Long non-coding RNA HCG11 sponging miR-522-3p inhibits the tumorigenesis of non-small cell lung cancer by upregulating SOCS5. Fan G, Jiao J, Shen F, Ren Q, Wang Q, Chu F. Thorac Cancer. 2020 Oct;11(10):2877-2886.

  • miR-522 Modulated the Expression of Proinflammatory Cytokines and Matrix Metalloproteinases Partly via Targeting Suppressor of Cytokine Signaling 3 in Rheumatoid Arthritis Synovial Fibroblasts. Wang X, Si X, Sun J, Yue L, Wang J, Yu Z. DNA Cell Biol. 2018 Apr;37(4):405-415.

  • Novel involvement of miR-522-3p in high-mobility group box 1-induced prostaglandin reductase 1 expression and reduction of phagocytosis. Kang GJ, Lee HJ, Byun HJ, Kim EJ, Kim HJ, Park MK, Lee CH. Biochim Biophys Acta Mol Cell Res. 2017 Apr;1864(4):625-633.

  • miR-522 contributes to cell proliferation of hepatocellular carcinoma by targeting DKK1 and SFRP2. Zhang H, Yu C, Chen M, Li Z, Tian S, Jiang J, Sun C. Tumour Biol. 2016 Aug;37(8):11321-9.

  • MicroRNA-522 reverses drug resistance of doxorubicin-induced HT29 colon cancer cell by targeting ABCB5. Yang G, Jiang O, Ling D, Jiang X, Yuan P, Zeng G, Zhu J, Tian J, Weng Y, Wu D. Mol Med Rep. 2015 Sep;12(3):3930-3936.

  • MiR-522 contributes to cell proliferation of human glioblastoma cells by suppressing PHLPP1 expression. Zhang S, Zhang H, Zhu J, Zhang X, Liu Y. Biomed Pharmacother. 2015 Mar;70:164-9.

  • Sequencing of captive target transcripts identifies the network of regulated genes and functions of primate-specific miR-522. Tan SM, Kirchner R, Jin J, Hofmann O, McReynolds L, Hide W, Lieberman J. Cell Rep. 2014 Aug 21;8(4):1225-39.

  • The PLIN4 variant rs8887 modulates obesity related phenotypes in humans through creation of a novel miR-522 seed site. Richardson K, Louie-Gao Q, Arnett DK, Parnell LD, Lai CQ, Davalos A, Fox CS, Demissie S, Cupples LA, Fernandez-Hernando C, Ordovas JM. PLoS One. 2011 Apr 20;6(4):e17944.

  • miRBase: integrating microRNA annotation and deep-sequencing data. Kozomara A, Griffiths-Jones S. Nucleic Acids Res. 2011 Jan;39(Database issue):D152-7.

  • Patterns of known and novel small RNAs in human cervical cancer. Lui WO, Pourmand N, Patterson BK, Fire A. Cancer Res. 2007 Jul 1;67(13):6031-43.

  • A mammalian microRNA expression atlas based on small RNA library sequencing. Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foà R, Schliwka J, Fuchs U, Novosel A, Müller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Weir DB, Choksi R, De Vita G, Frezzetti D, Trompeter HI, Hornung V, Teng G, Hartmann G, Palkovits M, Di Lauro R, Wernet P, Macino G, Rogler CE, Nagle JW, Ju J, Papavasiliou FN, Benzing T, Lichter P, Tam W, Brownstein MJ, Bosio A, Borkhardt A, Russo JJ, Sander C, Zavolan M, Tuschl T. Cell. 2007 Jun 29;129(7):1401-14.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.

  • Identification of hundreds of conserved and nonconserved human microRNAs. Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z. Nat Genet. 2005 Jul;37(7):766-70.