Precursor miRNA: hsa-mir-517a

Precursor miRNA

Precursor Name hsa-mir-517a
Genomic Location chr19:53712268-53712354 (+); nearby genomic features
Clustered miRNAs hsa-mir-518b,hsa-mir-526a-1,hsa-mir-520c,hsa-mir-518c,hsa-mir-524,hsa-mir-517a,hsa-mir-519d,hsa-mir-521-2,hsa-mir-520d,hsa-mir-517b,hsa-mir-520g (within 10kb in genome)
NCBI GENE ID 574479
miRBase ID MI0003161
Precursor Sequence 
              c       u   a    u    g  g a
ucucaggcagugac cucuaga gga gcac gucu uu u u
|||||||||||||| ||||||| ||| |||| |||| || |  a
agaguuugucauug gagauuu ccu cgug uaga aa a a
              u       c   a    c    a  g a

Mature miRNA

Mature Name hsa-miR-517a-3p
Previous Name hsa-miR-517a
Mature Sequence 5' - aucgugcaucccuuuagagugu - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0002852
Similar miRNAs hsa-miR-517b-3p, hsa-miR-517c-3p (sharing the same seed sequence with hsa-miR-517a-3p).

References

  • A placental specific miRNA miR-517a-3p exerts anti-human cytomegalovirus activity. Hamilton ST, Hahn F, Sonntag E, Marschall M, Rawlinson WD. Placenta. 2021 Sep 1;112:62-65.

  • LncRNA-SNX17 Promotes HTR-8/SVneo Proliferation and Invasion Through miR-517a/IGF-1 in the Placenta of Diabetic Macrosomia. Guiyu S, Quan N, Ruochen W, Dan W, Bingnan C, Yuanyua L, Yue B, Feng J, Chong Q, Leilei W. Reprod Sci. 2022 Feb;29(2):596-605.

  • Unc-13 homolog D mediates an antiviral effect of the chromosome 19 microRNA cluster miR-517a. Krawczynski K, Ouyang Y, Mouillet JF, Chu T, Coyne CB, Sadovsky Y. J Cell Sci. 2020 Nov 19;134(5):jcs246769.

  • Up-regulation of miR-517-5p inhibits ERK/MMP-2 pathway: potential role in preeclampsia. Fu JY, Xiao YP, Ren CL, Guo YW, Qu DH, Zhang JH, Zhu YJ. Eur Rev Med Pharmacol Sci. 2018 Oct;22(20):6599-6608.

  • Increased Levels of Cell-Free miR-517a and Decreased Levels of Cell-Free miR-518b in Maternal Plasma Samples From Placenta Previa Pregnancies at 32 Weeks of Gestation. Hasegawa Y, Miura K, Higashijima A, Abe S, Miura S, Yoshiura K, Masuzaki H. Reprod Sci. 2015 Dec;22(12):1569-76.

  • Placental expression of miR-517a/b and miR-517c contributes to trophoblast dysfunction and preeclampsia. Anton L, Olarerin-George AO, Hogenesch JB, Elovitz MA. PLoS One. 2015 Mar 23;10(3):e0122707.

  • Human exosomal placenta-associated miR-517a-3p modulates the expression of PRKG1 mRNA in Jurkat cells. Kambe S, Yoshitake H, Yuge K, Ishida Y, Ali MM, Takizawa T, Kuwata T, Ohkuchi A, Matsubara S, Suzuki M, Takeshita T, Saito S, Takizawa T. Biol Reprod. 2014 Nov;91(5):129.

  • MiR-517a-3p accelerates lung cancer cell proliferation and invasion through inhibiting FOXJ3 expression. Jin J, Zhou S, Li C, Xu R, Zu L, You J, Zhang B. Life Sci. 2014 Jul 11;108(1):48-53.

  • Down-regulation of miR-517a and miR-517c promotes proliferation of hepatocellular carcinoma cells via targeting Pyk2. Liu RF, Xu X, Huang J, Fei QL, Chen F, Li YD, Han ZG. Cancer Lett. 2013 Feb 28;329(2):164-73.

  • Underexpression of 4 placenta-associated microRNAs in complete hydatidiform moles. Na Q, Wang D, Song W. Int J Gynecol Cancer. 2012 Jul;22(6):1075-80.

  • Restoration of miR-517a expression induces cell apoptosis in bladder cancer cell lines. Yoshitomi T, Kawakami K, Enokida H, Chiyomaru T, Kagara I, Tatarano S, Yoshino H, Arimura H, Nishiyama K, Seki N, Nakagawa M. Oncol Rep. 2011 Jun;25(6):1661-8.

  • miRBase: integrating microRNA annotation and deep-sequencing data. Kozomara A, Griffiths-Jones S. Nucleic Acids Res. 2011 Jan;39(Database issue):D152-7.

  • The two stem cell microRNA gene clusters C19MC and miR-371-3 are activated by specific chromosomal rearrangements in a subgroup of thyroid adenomas. Rippe V, Dittberner L, Lorenz VN, Drieschner N, Nimzyk R, Sendt W, Junker K, Belge G, Bullerdiek J. PLoS One. 2010 Mar 3;5(3):e9485.

  • A mammalian microRNA expression atlas based on small RNA library sequencing. Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foà R, Schliwka J, Fuchs U, Novosel A, Müller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Weir DB, Choksi R, De Vita G, Frezzetti D, Trompeter HI, Hornung V, Teng G, Hartmann G, Palkovits M, Di Lauro R, Wernet P, Macino G, Rogler CE, Nagle JW, Ju J, Papavasiliou FN, Benzing T, Lichter P, Tam W, Brownstein MJ, Bosio A, Borkhardt A, Russo JJ, Sander C, Zavolan M, Tuschl T. Cell. 2007 Jun 29;129(7):1401-14.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.

  • Identification of hundreds of conserved and nonconserved human microRNAs. Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z. Nat Genet. 2005 Jul;37(7):766-70.