Precursor miRNA: hsa-mir-342

Precursor miRNA

Precursor Name hsa-mir-342
Genomic Location chr14:100109655-100109753 (+); nearby genomic features
Clustered miRNAs hsa-mir-151b,hsa-mir-342 (within 10kb in genome)
NCBI GENE ID 442909
miRBase ID MI0000805
Precursor Sequence 
gaaac     u        g      --ua      auuga      ugg  a
     ugggc caagguga gggugc    ucugug     gggaca   uu a
     ||||| |||||||| ||||||    ||||||     ||||||   || 
     auccg guuccacu cccacg    agacac     cucugu   ag u
-auuc     -        g      cuaa      ----a      -ua  g

Mature miRNA

Mature Name hsa-miR-342-5p
Mature Sequence 5' - aggggugcuaucugugauuga - 3' (length = 21)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0004694
Similar miRNAs hsa-miR-4664-5p (sharing the same seed sequence with hsa-miR-342-5p).

Mature miRNA

Mature Name hsa-miR-342-3p
Previous Name hsa-miR-342
Mature Sequence 5' - ucucacacagaaaucgcacccgu - 3' (length = 23)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000753

References

  • MIAT promotes myofibroblastic activities and transformation in oral submucous fibrosis through sponging the miR-342-3p/SOX6 axis. Lu MY, Fang CY, Hsieh PL, Chao SC, Liao YW, Ohiro Y, Yu CC, Ho DC. Aging (Albany NY). 2024 Oct 7;16(19):12909-12927.

  • DNMT1-Mediated the Downregulation of FOXF1 Promotes High Glucose-induced Podocyte Damage by Regulating the miR-342-3p/E2F1 Axis. Chen JH, Ye L, Zhu SL, Yang Y, Xu N. Cell Biochem Biophys. 2024 Sep;82(3):2957-2975.

  • LINC00624 affects hepatocellular carcinoma proliferation and apoptosis through the miR-342-3p/DNAJC5 axis. Xu H, Shen P, Fang J, Jiang J, Shi Y, Xu P, Jiang R, Wang Z. J Biochem Mol Toxicol. 2024 Feb;38(2):e23650.

  • The Regulation of Fatty Acid Synthase by Exosomal miR-143-5p and miR-342-5p in Idiopathic Pulmonary Fibrosis. Hayek H, Rehbini O, Kosmider B, Brandt T, Chatila W, Marchetti N, Criner GJ, Bolla S, Kishore R, Bowler RP, Bahmed K. Am J Respir Cell Mol Biol. 2024 Apr;70(4):259-282.

  • Tenogenic differentiation of human tendon-derived stem cells induced by long non-coding RNA LINCMD1 via miR-342-3p/EGR1 axis. Qu F, Shen X, Wang K, Sun C, Li P. Connect Tissue Res. 2023 Sep;64(5):479-490.

  • A study of differential microRNA expression profile in migraine: the microMIG exploratory study. Gallardo VJ, Gómez-Galván JB, Asskour L, Torres-Ferrús M, Alpuente A, Caronna E, Pozo-Rosich P. J Headache Pain. 2023 Feb 17;24(1):11.

  • [Expression of miR-342-3p in rheumatoid arthritis patients and its effect on synovial fibroblast inflammation and migration]. Zhou Q, Liu J, Sun Y, Chen X, Zhang X, Ding X. Nan Fang Yi Ke Da Xue Xue Bao. 2022 Nov 20;42(11):1712-1719.

  • Circulating Small Extracellular Vesicle-Derived miR-342-5p Ameliorates Beta-Amyloid Formation via Targeting Beta-site APP Cleaving Enzyme 1 in Alzheimer's Disease. Dong Z, Gu H, Guo Q, Liu X, Li F, Liu H, Sun L, Ma H, Zhao K. Cells. 2022 Nov 29;11(23):3830.

  • miR-342-3p Inhibits Acute Myeloid Leukemia Progression by Targeting SOX12. Wang Y, Guo X, Wang L, Xing L, Zhang X, Ren J. Oxid Med Cell Longev. 2022 Sep 8;2022:1275141.

  • Downregulation of microRNA-342-3p Eases Insulin Resistance and Liver Gluconeogenesis via Regulating Rfx3 in Gestational Diabetes Mellitus. Sun Y, Yu Z, Zhang Y, Wang H, Chi Z, Chen X, Xu D. Crit Rev Eukaryot Gene Expr. 2022;32(6):83-95.

  • Extracellular Vesicle-Derived circITGB1 Regulates Dendritic Cell Maturation and Cardiac Inflammation via miR-342-3p/NFAM1. Zhu J, Chen Z, Peng X, Zheng Z, Le A, Guo J, Ma L, Shi H, Yao K, Zhang S, Ge J, Zheng Z, Wang Q. Oxid Med Cell Longev. 2022 May 16;2022:8392313.

  • miR-342-5p inhibits odonto/osteogenic differentiation of human dental pulp stem cells via targeting Wnt7b. Zeng K, Li W, Kang Q, Li Y, Cheng Q, Xia W. Oral Dis. 2023 Jul;29(5):2107-2116.

  • Mesenchymal stem cell-derived exosome mir-342-3p inhibits metastasis and chemo-resistance of breast cancer through regulating ID4. Yu S, Zhou Y, Niu L, Qiao Y, Yan Y. Genes Genomics. 2022 May;44(5):539-550.

  • Aberrantly reduced expression of miR-342-5p contributes to CCND1-associated chronic myeloid leukemia progression and imatinib resistance. Wu YY, Lai HF, Huang TC, Chen YG, Ye RH, Chang PY, Lai SW, Chen YC, Lee CH, Liu WN, Dai MS, Chen JH, Ho CL, Chiu YL. Cell Death Dis. 2021 Oct 5;12(10):908.

  • Long non-coding RNA ASMTL-AS1 deteriorates the oncogenicity of osteosarcoma by decoying microRNA-342-3p and consequently raising ADAM9 expression. Hou C, Sun F, Sun M. Biochem Biophys Res Commun. 2021 Nov 19;579:89-96.

  • miR-342-3p Regulates the Proliferation and Apoptosis of NSCLC Cells by Targeting Chen Z, Ying J, Shang W, Ding D, Guo M, Wang H. Technol Cancer Res Treat. 2021 Jan-Dec;20:15330338211041193.

  • Dysregulation of miR-342-3p in plasma exosomes derived from convalescent AMI patients and its consequences on cardiac repair. Wang B, Cao C, Han D, Bai J, Guo J, Guo Q, Li D, Zhang J, Zhang Z, Wang Y, Tang J, Shen D, Zhang J. Biomed Pharmacother. 2021 Oct;142:112056.

  • MiR-342 controls Mycobacterium tuberculosis susceptibility by modulating inflammation and cell death. Fu B, Lin X, Tan S, Zhang R, Xue W, Zhang H, Zhang S, Zhao Q, Wang Y, Feldman K, Shi L, Zhang S, Nian W, Chaitanya Pavani K, Li Z, Wang X, Wu H. EMBO Rep. 2021 Sep 6;22(9):e52252.

  • Tumor Suppressive Role of miR-342-5p in Human Chondrosarcoma Cells and 3D Organoids. Veys C, Benmoussa A, Contentin R, Duchemin A, Brotin E, Lafont JE, Saintigny Y, Poulain L, Denoyelle C, Demoor M, Legendre F, Galéra P. Int J Mol Sci. 2021 May 25;22(11):5590.

  • MicroRNA-342 Promotes the Malignant-Like Phenotype of Endometrial Stromal Cells via Regulation of Annexin A2. Sun D, Wang Y, Wang L, Guo X. Anal Cell Pathol (Amst). 2021 May 15;2021:1328682.

    • There are 95 references associated with hsa-mir-342. Click here to see the complete list in PubMed.