Precursor miRNA: hsa-mir-331

Precursor miRNA

Precursor Name hsa-mir-331
Genomic Location chr12:95308420-95308513 (+); nearby genomic features
Clustered miRNAs hsa-mir-331,hsa-mir-3685 (within 10kb in genome)
NCBI GENE ID 442903
miRBase ID MI0000812
Precursor Sequence 
gaguuugguuuu         u        u    u       au ccaga
            guuuggguu guucuagg augg cccaggg  c     u
            ||||||||| |||||||| |||| |||||||  |      c
            cgaauccaa caagaucc uauc ggguccc  g     a
----------cu         c        -    c       cg accaa

Mature miRNA

Mature Name hsa-miR-331-3p
Previous Name hsa-miR-331
Mature Sequence 5' - gccccugggccuauccuagaa - 3' (length = 21)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000760

References

  • Circ_0005615 restrains the progression of multiple myeloma through modulating miR-331-3p and IGF1R regulatory cascade. Zhang Q, Duan H, Yang W, Liu H, Tao X, Zhang Y. J Orthop Surg Res. 2023 May 12;18(1):356.

  • LncRNA HOTAIR enhances RCC2 to accelerate cervical cancer progression by sponging miR-331-3p. Buranjiang G, Abuduwanke A, Li X, Abulizi G. Clin Transl Oncol. 2023 Jun;25(6):1650-1660.

  • MicroRNA miR-331-3p suppresses osteosarcoma progression via the Bcl-2/Bax and Wnt/β-Catenin signaling pathways and the epithelial-mesenchymal transition by targeting N-acetylglucosaminyltransferase I (MGAT1). Bi W, Yang M, Xing P, Huang T. Bioengineered. 2022 Jun;13(6):14159-14174.

  • Circular RNA circPSAP functions as an efficient miR-331-3p sponge to regulate proliferation, apoptosis and bortezomib sensitivity of human multiple myeloma cells by upregulating HDAC4. Ma H, Shen L, Yang H, Gong H, Du X. J Pharmacol Sci. 2022 May;149(1):27-36.

  • The circRNA circSIAE Inhibits Replication of Coxsackie Virus B3 by Targeting miR-331-3p and Thousand and One Amino-Acid Kinase 2. Yang Q, Li Y, Wang Y, Qiao X, Liu T, Wang H, Shen H. Front Cell Infect Microbiol. 2022 Jan 24;11:779919.

  • Long non-coding RNA anti-differentiation non-coding RNA affects proliferation, invasion, and migration of breast cancer cells by targeting miR-331. Jiang C, Shi X, Yi D, Wang R, Xu F, Guan W, Sang J. Bioengineered. 2021 Dec;12(2):12236-12245.

  • Circular RNA hsa_circ_0026552 inhibits the proliferation, migration and invasion of trophoblast cells via the miR‑331‑3p/TGF‑βR1 axis in pre‑eclampsia. Shan L, Hou X. Mol Med Rep. 2021 Nov;24(5):798.

  • Circ_0062270 upregulates EPHA2 to facilitate melanoma progression via sponging miR-331-3p. Chen X, Tang Y, Yan J, Li L, Jiang L, Chen Y. J Dermatol Sci. 2021 Sep;103(3):176-182.

  • LncRNA FOXD2-AS1 promotes cell proliferation and invasion of fibroblast-like synoviocytes by regulation of miR-331-3p/PIAS3 pathway in rheumatoid arthritis. Zhao Q, Zhao F, Liu C, Xu T, Song K. Autoimmunity. 2021 Aug;54(5):254-263.

  • MicroRNA‑331 inhibits isoproterenol‑induced expression of profibrotic genes in cardiac myofibroblasts via the TGFβ/smad3 signaling pathway. Yousefi F, Soltani BM, Rabbani S. Sci Rep. 2021 Jan 28;11(1):2548.

  • MiR-331-3p Links to Drug Resistance of Pancreatic Cancer Cells by Activating WNT/β-Catenin Signal via ST7L. Zhan T, Chen X, Tian X, Han Z, Liu M, Zou Y, Huang S, Chen A, Cheng X, Deng J, Tan J, Huang X. Technol Cancer Res Treat. 2020 Jan-Dec;19:1533033820945801.

  • miR-331-3p is involved in glucocorticoid resistance reversion by rapamycin through suppression of the MAPK signaling pathway. Lucafò M, Sicari D, Chicco A, Curci D, Bellazzo A, Di Silvestre A, Pegolo C, Autry R, Cecchin E, De Iudicibus S, Collavin L, Evans W, Decorti G, Stocco G. Cancer Chemother Pharmacol. 2020 Sep;86(3):361-374.

  • Regulation of ABO blood group antigen expression by miR-331-3p and miR-1908-5p during hematopoietic stem cell differentiation. Kronstein-Wiedemann R, Nowakowska P, Milanov P, Gubbe K, Seifried E, Bugert P, Chavakis T, Tonn T. Stem Cells. 2020 Oct 1;38(10):1348-1362.

  • Potential targets and molecular mechanism of miR-331-3p in hepatocellular carcinoma identified by weighted gene coexpression network analysis. Chi Q, Geng X, Xu K, Wang C, Zhao H. Biosci Rep. 2020 Jun 26;40(6):BSR20200124.

  • RIG-I regulates myeloid differentiation by promoting TRIM25-mediated ISGylation. Wu SF, Xia L, Shi XD, Dai YJ, Zhang WN, Zhao JM, Zhang W, Weng XQ, Lu J, Le HY, Tao SC, Zhu J, Chen Z, Wang YY, Chen S. Proc Natl Acad Sci U S A. 2020 Jun 23;117(25):14395-14404.

  • MicroRNA-331 and microRNA-151-3p as biomarkers in patients with ST-segment elevation myocardial infarction. Horváth M, Horváthová V, Hájek P, Å tÄ›chovský C, HonÄ›k J, Å enolt L, Veselka J. Sci Rep. 2020 Apr 3;10(1):5845.

  • miR-331-3p Suppresses Cell Proliferation in TNBC Cells by Downregulating NRP2. Zhao M, Zhang M, Tao Z, Cao J, Wang L, Hu X. Technol Cancer Res Treat. 2020 Jan-Dec;19:1533033820905824.

  • microRNA-331-3p maintains the contractile type of vascular smooth muscle cells by regulating TNF-α and CD14 in intracranial aneurysm. Fan W, Liu Y, Li C, Qu X, Zheng G, Zhang Q, Pan Z, Wang Y, Rong J. Neuropharmacology. 2020 Mar 1;164:107858.

  • Circulating microRNAs miR-331 and miR-195 differentiate local luminal a from metastatic breast cancer. McAnena P, Tanriverdi K, Curran C, Gilligan K, Freedman JE, Brown JAL, Kerin MJ. BMC Cancer. 2019 May 10;19(1):436.

  • Evaluation of miR-331-3p and miR-23b-3p as serum biomarkers for hepatitis c virus-related hepatocellular carcinoma at early stage. Sun Q, Li J, Jin B, Wang T, Gu J. Clin Res Hepatol Gastroenterol. 2020 Feb;44(1):21-28.

    • There are 49 references associated with hsa-mir-331. Click here to see the complete list in PubMed.