Precursor miRNA: hsa-mir-30c-2

Precursor miRNA

Precursor Name hsa-mir-30c-2
Genomic Location chr6:71376960-71377031 (-); nearby genomic features
NCBI GENE ID 407032
miRBase ID MI0000254
Precursor Sequence 
   uacu       u   aca         guggaa
aga    guaaaca ccu   cucucagcu      a
|||    ||||||| |||   |||||||||      
ucu    cauuugu gga   gagggucga      g
   uucu       c   --a         aagaau

Mature miRNA

Mature Name hsa-miR-30c-5p
Previous Name hsa-miR-30c
Mature Sequence 5' - uguaaacauccuacacucucagc - 3' (length = 23)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000244
Similar miRNAs hsa-miR-30a-5p, hsa-miR-30b-5p, hsa-miR-30d-5p, hsa-miR-30e-5p (sharing the same seed sequence with hsa-miR-30c-5p).

Mature miRNA

Mature Name hsa-miR-30c-2-3p
Previous Name hsa-miR-30c-2*
Mature Sequence 5' - cugggagaaggcuguuuacucu - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0004550
Similar miRNAs hsa-miR-30c-1-3p, hsa-miR-6788-5p (sharing the same seed sequence with hsa-miR-30c-2-3p).

References

  • LINC01234 promoted malignant behaviors of breast cancer cells via hsa-miR-30c-2-3p/CCT4/mTOR signaling pathway. Tang C, Li C, Chen C, Chen T, Zhu J, Sun M, Wang P, Han C. Taiwan J Obstet Gynecol. 2024 Jan;63(1):46-56.

  • MiR-30c-5p-Targeted Regulation of GNAI2 Improves Neural Function Injury and Inflammation in Cerebral Ischemia-Reperfusion Injury. Deng X, Zeng Y, Ding D. Appl Biochem Biotechnol. 2024 Aug;196(8):5235-5248.

  • MicroRNA-30c-5p arrests bladder cancer G2/M phase and suppresses its progression by targeting PRC1-mediated blocking of CDK1/Cyclin B1 axis. Hao Y, Zhu Y, Sun F, Xu D, Wang C. Cell Signal. 2023 Oct;110:110836.

  • MicroRNA-30c-2-3p targets STRIP2 to suppress malignant progression of gastric cancer cells. Wu J, Lu G, Zhou S, Jin Z, Fang F. J Biochem. 2022 Mar 31;171(4):451-457.

  • MiR-30c-5p loss-induced PELI1 accumulation regulates cell proliferation and migration via activating PI3K/AKT pathway in papillary thyroid carcinoma. Zheng T, Zhou Y, Xu X, Qi X, Liu J, Pu Y, Zhang S, Gao X, Luo X, Li M, Wang X, Dong L, Wang Y, Mao C. J Transl Med. 2022 Jan 6;20(1):20.

  • METTL14-Mediated miR-30c-1-3p Maturation Represses the Progression of Lung Cancer via Regulation of MARCKSL1 Expression. Li F, Zhao J, Wang L, Chi Y, Huang X, Liu W. Mol Biotechnol. 2022 Feb;64(2):199-212.

  • Circ3823 contributes to growth, metastasis and angiogenesis of colorectal cancer: involvement of miR-30c-5p/TCF7 axis. Guo Y, Guo Y, Chen C, Fan D, Wu X, Zhao L, Shao B, Sun Z, Ji Z. Mol Cancer. 2021 Jun 25;20(1):93.

  • Integrating serum microRNAs and electronic health records improved the diagnosis of tuberculosis. Gao SH, Chen CG, Zhuang CB, Zeng YL, Zeng ZZ, Wen PH, Yu YM, Ming L, Zhao JW. J Clin Lab Anal. 2021 Aug;35(8):e23871.

  • MicroRNA-30c delivered by bone marrow-mesenchymal stem cells induced apoptosis and diminished cell invasion in U-251 glioblastoma cell line. Mahjoor M, Afkhami H, Mollaei M, Nasr A, Shahriary S, Khorrami S. Life Sci. 2021 Aug 15;279:119643.

  • miR-30c inhibits angiogenesis by targeting delta-like ligand 4 in liver sinusoidal endothelial cell to attenuate liver fibrosis. Gu T, Shen B, Li B, Guo Y, Li F, Ma Z, Chen L, Zhang Q, Qu Y, Dong H, Cai X, Lu L. FASEB J. 2021 May;35(5):e21571.

  • Embryo morphokinetic score is associated with biomarkers of developmental competence and implantation. Coticchio G, Pennetta F, Rizzo R, Tarozzi N, Nadalini M, Orlando G, Centonze C, Gioacchini G, Borini A. J Assist Reprod Genet. 2021 Jul;38(7):1737-1743.

  • MiR-30c-5p Directly Targets MAPK1 to Regulate the Proliferation, Migration and Invasion of Adenomyotic Epithelial Cells in Adenomyosis. Zhang A, Liu X, Wang J, Deng K, Wang J. Twin Res Hum Genet. 2021 Feb;24(1):22-28.

  • MiR-30c-5p regulates adventitial progenitor cells differentiation to vascular smooth muscle cells through targeting OPG. Zhang Q, Chen T, Zhang Y, Lyu L, Zhang B, Huang C, Zhou X, Wu Y, Li Z. Stem Cell Res Ther. 2021 Jan 19;12(1):67.

  • Long non-coding RNA CASC7 is associated with the pathogenesis of heart failure via modulating the expression of miR-30c. Xu YL, Liu Y, Cai RP, He SR, Dai RX, Yang XH, Kong BH, Qin ZB, Su Q. J Cell Mol Med. 2020 Oct;24(19):11500-11511.

  • Expression of micro-RNA hsa-miR-30c-5p and hsa-miR-138-1 in renal cell carcinoma. Onyshchenko KV, Voitsitskyi TV, Grygorenko VM, Saidakova NO, Pereta LV, Onyschuk AP, Skrypkina IY. Exp Oncol. 2020 Jun;42(2):115-119.

  • LncRNA RP11-361F15.2 promotes osteosarcoma tumorigenesis by inhibiting M2-Like polarization of tumor-associated macrophages of CPEB4. Yang D, Liu K, Fan L, Liang W, Xu T, Jiang W, Lu H, Jiang J, Wang C, Li G, Zhang X. Cancer Lett. 2020 Mar 31;473:33-49.

  • MicroRNA-30c inhibits pancreatic cancer cell proliferation by targeting twinfilin 1 and indicates a poor prognosis. Sun LL, Cheng M, Xu XD. World J Gastroenterol. 2019 Nov 14;25(42):6311-6321.

  • LINC01342 promotes the progression of ovarian cancer by absorbing microRNA-30c-2-3p to upregulate HIF3A. Zhang C, Liu J, Zhang Y, Luo C, Zhu T, Zhang R, Yao R. J Cell Physiol. 2020 Apr;235(4):3939-3949.

  • Urinary exosome miR-30c-5p as a biomarker of clear cell renal cell carcinoma that inhibits progression by targeting HSPA5. Song S, Long M, Yu G, Cheng Y, Yang Q, Liu J, Wang Y, Sheng J, Wang L, Wang Z, Xu B. J Cell Mol Med. 2019 Oct;23(10):6755-6765.

  • MiR-30c exerts tumor suppressive functions in colorectal carcinoma by directly targeting BCL9. Zhao DW, Li MM, Han JP, Wang Y, Jiang LX, Chang HL. Eur Rev Med Pharmacol Sci. 2019 Apr;23(8):3335-3343.

    • There are 67 references associated with hsa-mir-30c-2. Click here to see the complete list in PubMed.