Mature miRNA: hsa-miR-30c-5p

Mature miRNA

miRNA Name hsa-miR-30c-5p
Previous Name hsa-miR-30c
miRNA Sequence 5' - uguaaacauccuacacucucagc - 3' (length = 23)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000244
Similar miRNAs hsa-miR-30a-5p, hsa-miR-30b-5p, hsa-miR-30d-5p, hsa-miR-30e-5p (sharing the same seed sequence with hsa-miR-30c-5p).

Precursor miRNA

Precursor Name hsa-mir-30c-1
Genomic Location chr1:40757284-40757372 (+); nearby genomic features
Clustered miRNAs hsa-mir-30e,hsa-mir-30c-1 (within 10kb in genome)
NCBI GENE ID 407031
MIM ID 615151
miRBase ID MI0000736
Precursor Sequence 
a     cu    ugu u       u   aca         ---g  a
 ccaug  guag   g guaaaca ccu   cucucagcu    ug g
 |||||  ||||   | ||||||| |||   |||||||||    || 
 gguac  cguc   c cauuugu ggg   gagggucgg    ac c
a     --    uuc u       u   --a         ugga  u
Precursor Name hsa-mir-30c-2
Genomic Location chr6:71376960-71377031 (-); nearby genomic features
NCBI GENE ID 407032
miRBase ID MI0000254
Precursor Sequence 
   uacu       u   aca         guggaa
aga    guaaaca ccu   cucucagcu      a
|||    ||||||| |||   |||||||||      
ucu    cauuugu gga   gagggucga      g
   uucu       c   --a         aagaau

References

  • LINC01234 promoted malignant behaviors of breast cancer cells via hsa-miR-30c-2-3p/CCT4/mTOR signaling pathway. Tang C, Li C, Chen C, Chen T, Zhu J, Sun M, Wang P, Han C. Taiwan J Obstet Gynecol. 2024 Jan;63(1):46-56.

  • MiR-30c-5p-Targeted Regulation of GNAI2 Improves Neural Function Injury and Inflammation in Cerebral Ischemia-Reperfusion Injury. Deng X, Zeng Y, Ding D. Appl Biochem Biotechnol. 2024 Aug;196(8):5235-5248.

  • MicroRNA-30c-5p arrests bladder cancer G2/M phase and suppresses its progression by targeting PRC1-mediated blocking of CDK1/Cyclin B1 axis. Hao Y, Zhu Y, Sun F, Xu D, Wang C. Cell Signal. 2023 Oct;110:110836.

  • Long non-coding RNA MALAT1 sponges miR-30c to promote the calcification of human vascular smooth muscle cells by regulating Runx2. Gong Y, Zhong Q, Xia Y, Wen Y, Gan H. Ren Fail. 2023 Dec;45(1):2204953.

  • miR-30c plays diagnostic and prognostic roles and mediates epithelial-mesenchymal transition (EMT) and proliferation of gliomas by affecting Notch1. Li M, Liu W, Li J, Zhang H, Xu J. Sci Rep. 2022 Sep 30;12(1):16404.

  • MiR-30c facilitates natural killer cell cytotoxicity to lung cancer through targeting GALNT7. Gao F, Han J, Jia L, He J, Wang Y, Chen M, Liu X, He X. Genes Genomics. 2023 Feb;45(2):247-260.

  • MiR-30c-1-3p targets matrix metalloproteinase 9 involved in the rupture of abdominal aortic aneurysms. Yang L, Sui HG, Wang MM, Li JY, He XF, Li JY, Wang XZ. J Mol Med (Berl). 2022 Aug;100(8):1209-1221.

  • Conformational Effects of a Cancer-Linked Mutation in Pri-miR-30c RNA. Jones AN, Walbrun A, Falleroni F, Rief M, Sattler M. J Mol Biol. 2022 Sep 30;434(18):167705.

  • MicroRNA-30c-2-3p targets STRIP2 to suppress malignant progression of gastric cancer cells. Wu J, Lu G, Zhou S, Jin Z, Fang F. J Biochem. 2022 Mar 31;171(4):451-457.

  • MiR-30c-5p loss-induced PELI1 accumulation regulates cell proliferation and migration via activating PI3K/AKT pathway in papillary thyroid carcinoma. Zheng T, Zhou Y, Xu X, Qi X, Liu J, Pu Y, Zhang S, Gao X, Luo X, Li M, Wang X, Dong L, Wang Y, Mao C. J Transl Med. 2022 Jan 6;20(1):20.

  • Effects and prognostic values of miR-30c-5p target genes in gastric cancer via a comprehensive analysis using bioinformatics. Hu S, Liu H, Zhang J, Li S, Zhou H, Gao Y. Sci Rep. 2021 Oct 18;11(1):20584.

  • METTL14-Mediated miR-30c-1-3p Maturation Represses the Progression of Lung Cancer via Regulation of MARCKSL1 Expression. Li F, Zhao J, Wang L, Chi Y, Huang X, Liu W. Mol Biotechnol. 2022 Feb;64(2):199-212.

  • Circ3823 contributes to growth, metastasis and angiogenesis of colorectal cancer: involvement of miR-30c-5p/TCF7 axis. Guo Y, Guo Y, Chen C, Fan D, Wu X, Zhao L, Shao B, Sun Z, Ji Z. Mol Cancer. 2021 Jun 25;20(1):93.

  • Integrating serum microRNAs and electronic health records improved the diagnosis of tuberculosis. Gao SH, Chen CG, Zhuang CB, Zeng YL, Zeng ZZ, Wen PH, Yu YM, Ming L, Zhao JW. J Clin Lab Anal. 2021 Aug;35(8):e23871.

  • MicroRNA-30c delivered by bone marrow-mesenchymal stem cells induced apoptosis and diminished cell invasion in U-251 glioblastoma cell line. Mahjoor M, Afkhami H, Mollaei M, Nasr A, Shahriary S, Khorrami S. Life Sci. 2021 Aug 15;279:119643.

  • miR-30c inhibits angiogenesis by targeting delta-like ligand 4 in liver sinusoidal endothelial cell to attenuate liver fibrosis. Gu T, Shen B, Li B, Guo Y, Li F, Ma Z, Chen L, Zhang Q, Qu Y, Dong H, Cai X, Lu L. FASEB J. 2021 May;35(5):e21571.

  • Embryo morphokinetic score is associated with biomarkers of developmental competence and implantation. Coticchio G, Pennetta F, Rizzo R, Tarozzi N, Nadalini M, Orlando G, Centonze C, Gioacchini G, Borini A. J Assist Reprod Genet. 2021 Jul;38(7):1737-1743.

  • MiR-30c-5p Directly Targets MAPK1 to Regulate the Proliferation, Migration and Invasion of Adenomyotic Epithelial Cells in Adenomyosis. Zhang A, Liu X, Wang J, Deng K, Wang J. Twin Res Hum Genet. 2021 Feb;24(1):22-28.

  • MiR-30c-5p regulates adventitial progenitor cells differentiation to vascular smooth muscle cells through targeting OPG. Zhang Q, Chen T, Zhang Y, Lyu L, Zhang B, Huang C, Zhou X, Wu Y, Li Z. Stem Cell Res Ther. 2021 Jan 19;12(1):67.

  • Evaluation of circulating miR-122, miR-30c and miR-33a levels and their association with lipids, lipoproteins in postprandial lipemia. Yaman SO, Orem A, Yucesan FB, Kural BV, Orem C. Life Sci. 2021 Jan 1;264:118585.

    • There are 114 references associated with hsa-miR-30c-5p. Click here to see the complete list in PubMed.