Precursor miRNA: hsa-mir-3065

Precursor miRNA

Precursor Name hsa-mir-3065
Genomic Location chr17:81125877-81125955 (+); nearby genomic features
Clustered miRNAs hsa-mir-657,hsa-mir-3065,hsa-mir-338,hsa-mir-1250 (within 10kb in genome)
NCBI GENE ID 100422915
miRBase ID MI0014228
Precursor Sequence 
   c            a   a   a     ------  g  g
cug ccucuucaacaa auc cug ugcug      ga uc c
||| |||||||||||| ||| ||| |||||      || || 
gac ggagagguuguu uag gac acgac      cu ag c
   a            a   -   c     ucacua  g  u

Mature miRNA

Mature Name hsa-miR-3065-5p
Mature Sequence 5' - ucaacaaaaucacugaugcugga - 3' (length = 23)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0015066

Mature miRNA

Mature Name hsa-miR-3065-3p
Mature Sequence 5' - ucagcaccaggauauuguuggag - 3' (length = 23)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0015378

References

  • Glioma stem cell-derived exosomes induce the transformation of astrocytes via the miR-3065-5p/DLG2 signaling axis. Li H, Zhu J, Liu X, Liu L, Huang S, Wu A, Xu Z, Zhang X, Li Z, Ni F, Liu L, Dong J. Glia. 2024 May;72(5):857-871.

  • Genome stability‑related lncRNA ZFPM2‑AS1 promotes tumor progression via miR‑3065‑5p/XRCC4 in hepatocellular carcinoma. Liu J, Zhang H, Xia P, Zhu Y, Xu K, Liu Z, Yuan Y. Int J Oncol. 2023 Feb;62(2):19.

  • miR-3065-3p promotes stemness and metastasis by targeting CRLF1 in colorectal cancer. Li Y, Xun J, Wang B, Ma Y, Zhang L, Yang L, Gao R, Guan J, Liu T, Gao H, Wang X, Zhang Q. J Transl Med. 2021 Oct 16;19(1):429.

  • A survey of microRNA single nucleotide polymorphisms identifies novel breast cancer susceptibility loci in a case-control, population-based study of African-American women. Bensen JT, Graff M, Young KL, Sethupathy P, Parker J, Pecot CV, Currin K, Haddad SA, Ruiz-Narváez EA, Haiman CA, Hong CC, Sucheston-Campbell LE, Zhu Q, Liu S, Yao S, Bandera EV, Rosenberg L, Lunetta KL, Ambrosone CB, Palmer JR, Troester MA, Olshan AF. Breast Cancer Res. 2018 Jun 5;20(1):45.

  • Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene. Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C. Cancer Res. 2011 Jan 1;71(1):78-86.

  • miRBase: integrating microRNA annotation and deep-sequencing data. Kozomara A, Griffiths-Jones S. Nucleic Acids Res. 2011 Jan;39(Database issue):D152-7.

  • Discovery of microRNAs and other small RNAs in solid tumors. Meiri E, Levy A, Benjamin H, Ben-David M, Cohen L, Dov A, Dromi N, Elyakim E, Yerushalmi N, Zion O, Lithwick-Yanai G, Sitbon E. Nucleic Acids Res. 2010 Oct;38(18):6234-46.

  • Characterization of the Melanoma miRNAome by Deep Sequencing. Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK. PLoS One. 2010 Mar 12;5(3):e9685.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.