Precursor miRNA: hsa-mir-296

Precursor miRNA

Precursor Name hsa-mir-296
Genomic Location chr20:58817615-58817694 (-); nearby genomic features
Clustered miRNAs hsa-mir-296,hsa-mir-298 (within 10kb in genome)
NCBI GENE ID 407022
MIM ID 610945
miRBase ID MI0000747
Precursor Sequence 
  ga      ca       c  c         g   ugc
ag  cccuuc  gagggcc cc cucaauccu uug   c
||  ||||||  ||||||| || ||||||||| |||    u
uc  gggaag  cucucgg gg ggguuggga gac   a
  uc      uc       a  u         -   uua

Mature miRNA

Mature Name hsa-miR-296-5p
Previous Name hsa-miR-296
Mature Sequence 5' - agggcccccccucaauccugu - 3' (length = 21)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000690

Mature miRNA

Mature Name hsa-miR-296-3p
Mature Sequence 5' - gaggguuggguggaggcucucc - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0004679

References

  • Extracellular vesicle-encapsulated microRNA-296-3p from cancer-associated fibroblasts promotes ovarian cancer development through regulation of the PTEN/AKT and SOCS6/STAT3 pathways. Sun L, Ke M, Yin M, Zeng Y, Ji Y, Hu Y, Fu S, Zhang C. Cancer Sci. 2024 Jan;115(1):155-169.

  • Overexpression of hsa_circ_0001861 inhibits pulmonary fibrosis through targeting miR-296-5p/BCL-2 binding component 3 axis. Wu T, Wu S, Jiao H, Feng J, Zeng X. Eur J Histochem. 2023 Oct 2;67(4):3839.

  • Investigating the expression level of miR-17-3p, miR-101-3p, miR-335-3p, and miR-296-3p in the peripheral blood of patients with acute myocardial infarction. Bakhshi A, Khani M, Alipour Parsa S, Khaheshi I, Namazi MH, Mazouri A, Bidram P, Safi M, Vakili H, Eslami V, Saadat H, Heidari L, Sohrabifar N. Mol Cell Biochem. 2024 Apr;479(4):859-868.

  • Elevated Expression of miR-296 in Human Placentas and Serum Samples From Pregnancies With Preeclampsia. Zhu D, Guo T, Xu J, Yuan D, Lin M, Yang M. Br J Biomed Sci. 2023 Apr 11;80:11004.

  • 3'UTR of SARS-CoV-2 spike gene hijack host miR-296 or miR-520h to disturb cell proliferation and cytokine signaling. Yuan J, Feng Z, Wang Q, Han L, Guan S, Liu L, Ye H, Xu L, Han X. Front Immunol. 2022 Sep 27;13:924667.

  • circ_000166/miR-296 Aggravates the Process of Diabetic Renal Fibrosis by Regulating the SGLT2 Signaling Pathway in Renal Tubular Epithelial Cells. Chen S. Dis Markers. 2022 May 16;2022:6103086.

  • Anti-senescent effects of long non-coding RNA H19 on human dermal fibroblast cells through impairing microRNA-296-5p-dependent inhibition of IGF2. Tang H, Yao F, Yin M, Liao Y, Li K, Li L, Xiao X, Guo J, Hu F, Feng H. Cell Signal. 2022 Jun;94:110327.

  • Tumor promoting effect of circ_002172 associates with induced immune escape in breast cancer via the miR-296-5p/CXCL12 axis. Li P, Ren X, Zheng Y, Sun J, Ye G. Int Immunopharmacol. 2022 May;106:108530.

  • Aloperine inhibits colorectal cancer cell proliferation and metastasis progress via regulating miR-296-5p/STAT3 axis. Han W, Kong D, Lu Q, Zhang W, Fan Z. Tissue Cell. 2022 Feb;74:101706.

  • MiR-296-3p inhibits cell proliferation by the SOX4-Wnt/βcatenin pathway in triple-negative breast cancer. Tian D, Luo L, Wang T, Qiao J. J Biosci. 2021;46:98.

  • Long non-coding RNA KCNQ1OT1 facilitates the progression of cervical cancer and tumor growth through modulating miR-296-5p/HYOU1 axis. Liu J, Wang Y. Bioengineered. 2021 Dec;12(1):8753-8767.

  • Circ_0000514 promotes breast cancer progression by regulating the miR-296-5p/CXCL10 axis. Li L, Feng G, Chen T, Zhang L. J Biochem. 2022 Jan 7;170(6):753-761.

  • Circ-E2F3 promotes cervical cancer progression by inhibiting microRNA-296-5p and increasing STAT3 nuclear translocation. Cao X, Ma Q, Wang B, Qian Q, Xi Y. Ann N Y Acad Sci. 2022 Jan;1507(1):84-98.

  • Pseudogene HSPB1P1 contributes to renal cell carcinoma proliferation and metastasis by targeting miR-296-5p to regulate HMGA1 expression. Chen Z, Wang Z, Chen Z, Fu F, Huang X, Huang Z. Cell Biol Int. 2021 Dec;45(12):2479-2489.

  • Glutamate receptor, ionotropic, N‑methyl D‑aspartate‑associated protein 1 promotes colorectal cancer cell proliferation and metastasis, and is negatively regulated by miR‑296‑3p. Yan Z, Li P, Xue Y, Tian H, Zhou T, Zhang G. Mol Med Rep. 2021 Oct;24(4):700.

  • CircRNA WHSC1 promotes non-small cell lung cancer progression via sponging microRNA-296-3p and up-regulating expression of AKT serine/threonine kinase 3. Shi F, Yang Q, Shen D, Chen J. J Clin Lab Anal. 2021 Aug;35(8):e23865.

  • Hsa_circRNA_102541 regulates the development of atherosclerosis by targeting miR-296-5p/PLK1 pathway. Du N, Li M, Yang D. Ir J Med Sci. 2022 Jun;191(3):1153-1159.

  • MiR-296-3p promotes the development and progression of preeclampsia via targeting the CEMIP. Li XS, Liang L, Zhang J, Tong MY, Xia CF, Yang QX, Wang XR. Eur Rev Med Pharmacol Sci. 2021 Jun;25(11):3938-3946.

  • Abnormal Expression of microRNA-296-3p in Type 2 Diabetes Patients and its Role in Pancreatic β-Cells Function by Targeting Tensin Homolog Deleted on Chromosome Ten. Cheng M, Guo Y, Zhong W, Chen X, Guo G. Biochem Genet. 2022 Feb;60(1):39-53.

  • M2 macrophage-derived exosomal long non-coding RNA AGAP2-AS1 enhances radiotherapy immunity in lung cancer by reducing microRNA-296 and elevating NOTCH2. Zhang F, Sang Y, Chen D, Wu X, Wang X, Yang W, Chen Y. Cell Death Dis. 2021 May 10;12(5):467.

    • There are 80 references associated with hsa-mir-296. Click here to see the complete list in PubMed.