Precursor miRNA: hsa-mir-27a

Precursor miRNA

Precursor Name hsa-mir-27a
Genomic Location chr19:13836440-13836517 (-); nearby genomic features
Clustered miRNAs hsa-mir-24-2,hsa-mir-27a,hsa-mir-23a (within 10kb in genome)
NCBI GENE ID 407018
MIM ID 612153
miRBase ID MI0000085
Precursor Sequence 
   a  a  a         ug  u       g  u cac
cug gg gc gggcuuagc  cu gugagca gg c   a
||| || || |||||||||  || ||||||| || |   
gac cc cg cuugaaucg  ga cacuugu cu g   c
   c  c  c         gu  -       g  - aac

Mature miRNA

Mature Name hsa-miR-27a-5p
Previous Name hsa-miR-27a*
Mature Sequence 5' - agggcuuagcugcuugugagca - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0004501

Mature miRNA

Mature Name hsa-miR-27a-3p
Previous Name hsa-miR-27a
Mature Sequence 5' - uucacaguggcuaaguuccgc - 3' (length = 21)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000084
Similar miRNAs hsa-miR-27b-3p, hsa-miR-9985 (sharing the same seed sequence with hsa-miR-27a-3p).

References

  • MiR-27a inhibits the growth and metastasis of multiple myeloma through regulating Th17/Treg balance. Lu W, Huang H, Xu Z, Xu S, Zhao K, Xiao M. PLoS One. 2024 Oct 16;19(10):e0311419.

  • METTL3-driven m6A modification of lncRNA FAM230B suppresses ferroptosis by modulating miR-27a-5p/BTF3 axis in gastric cancer. Cui Y, Pu M, Gong Y, Li R, Wang X, Ye J, Huang H, Liao D, Yang Y, Yin A, Li J, Deng Y, Tian Z, Pu R. Biochim Biophys Acta Gen Subj. 2024 Nov;1868(11):130714.

  • miR-27a-3p promotes inflammatory response in infectious endophthalmitis via targeting TSC1. Chen Y, Li S, He H. Sci Rep. 2024 Aug 21;14(1):19353.

  • MIR27A Ikonnikova A, Fedorinov D, Gryadunov D, Heydarov R, Lyadova M, Moskalenko A, Mikhailovich V, Emelyanova M, Lyadov V. Int J Mol Sci. 2024 Aug 4;25(15):8503.

  • The involvement of circulating miR-146a and miR-27a in patients with atherosclerotic cardiovascular disease after SARS-CoV-2 infection. Zhou J, Wei C, Li G, He W, Song M, Liu X, Feng J, Liu J. Clin Cardiol. 2024 Jun;47(6):e24274.

  • RNA-RNA interactions between respiratory syncytial virus and miR-26 and miR-27 are associated with regulation of cell cycle and antiviral immunity. Ressel S, Kumar S, Bermúdez-Barrientos JR, Gordon K, Lane J, Wu J, Abreu-Goodger C, Schwarze J, Buck AH. Nucleic Acids Res. 2024 May 22;52(9):4872-4888.

  • MiR-27a-3p exacerbates cell migration and invasion in right-sided/left-sided colorectal cancer by targeting TGFBR2/TCF7L2. Bi L, Zhou Y, Zhang Y, Zhang X. Cell Mol Biol (Noisy-le-grand). 2024 Jan 31;70(1):148-154.

  • MIR27A Ragia G, Biziota E, Koukaki T, Amarantidis K, Manolopoulos VG. Pharmacogenomics. 2024 Jan;25(2):59-67.

  • Functional Variants in MicroRNAs (rs895819, rs11614913 and rs2910164) Are Associated with Susceptibility and Clinicopathological Features in Mexican Patients with Colorectal Cancer. Trujillo-Fernández YGV, Yzabal-Barbedillo C, Saucedo-Sarinaña AM, Tovar-Jácome CJ, Godínez-Rodríguez MY, Barros-Núñez P, Gallegos-Arreola MP, Juárez-Vázquez CI, Pineda-Razo TD, Marín-Contreras ME, Rosales-Reynoso MA. Arch Iran Med. 2023 Aug 1;26(8):439-446.

  • MicroRNA miR-27a as a possible regulator of anti-inflammatory macrophage phenotype in preeclamptic placenta. Vishnyakova P, Gantsova E, Kiseleva V, Lazarev D, Knyazev E, Poltavets A, Iskusnykh M, Muminova K, Potapova A, Khodzhaeva Z, Elchaninov A, Fatkhudinov T, Sukhikh G. Placenta. 2024 Jan;145:151-161.

  • CircBCAR3 sponges miR-27a-3p and mediates ferroptosis in human B-prolymphocytic leukaemia cells via SLC7A11. Zhao G, Chen H, Luo J. Cell Mol Biol (Noisy-le-grand). 2023 Nov 30;69(12):181-187.

  • Genetic Variation in miR-27a Is Associated with Fluoropyrimidine-Associated Toxicity in Patients with Dihydropyrimidine Dehydrogenase Variants after Genotype-Guided Dose Reduction. Medwid S, Wigle TJ, Ross C, Kim RB. Int J Mol Sci. 2023 Aug 27;24(17):13284.

  • LINC00891 Attenuates the Proliferation and Metastasis of Osteosarcoma Cells via miR-27a-3p/TET1 Axis. Zhang S, Chen R. Genet Test Mol Biomarkers. 2023 Aug;27(8):248-257.

  • Inhibition of inflammation and infiltration of M2 macrophages in NSCLC through the ATF3/CSF1 axis: Role of miR-27a-3p. Zhou B, Xu Y, Xu L, Kong Y, Li K, Chen B, Li J. Int J Exp Pathol. 2023 Dec;104(6):292-303.

  • The Association of pre-miR27a Gene Polymorphism and Clinicopathological Data in Thai Breast Cancer Patients. Sanguansin S, Saelee P, Kritsiriwuthinan K, Pongstaporn W. Asian Pac J Cancer Prev. 2023 Jun 1;24(6):2055-2059.

  • lncRNA RMST suppresses the progression of colorectal cancer by competitively binding to miR-27a-3p/RXRα axis and inactivating Wnt signaling pathway. Chen S, Ji L, Wang Y, Zhang L, Xu M, Su Y, Zhang X. Acta Biochim Biophys Sin (Shanghai). 2023 May 29;55(5):726-735.

  • miR‑27a‑3p upregulation by p65 facilitates cervical tumorigenesis by increasing TAB3 expression and is involved in the positive feedback loop of NF‑κB signaling. Li M, Gao Z, Wang S, Zhao Y, Xie H. Oncol Rep. 2023 Jul;50(1):132.

  • Association of miR-196a2 and miR-27a polymorphisms with gestational diabetes mellitus susceptibility in a Chinese population. Zeng Q, Zou D, Liu N, Wei Y, Yang J, Wu W, Han F, He R, Guo R. Front Endocrinol (Lausanne). 2023 Apr 4;14:1127336.

  • MicroRNA-27a Suppresses the Toxic Action of Mepivacaine on Breast Cancer Cells via Inositol-Requiring Enzyme 1-TNF Receptor-Associated Factor 2. Fu W, Hu X, Li G, Liu S. Contrast Media Mol Imaging. 2023 Apr 10;2023:1153034.

  • MicroRNA-27a, downregulated in human obesity, exerts an antiapoptotic function in adipocytes. Liu L, Li D, Peng C, Gao R, Li X, Zhang L, Lv Q, Xiao X, Li Q. Endocr J. 2023 Jun 28;70(6):581-589.

    • There are 381 references associated with hsa-mir-27a. Click here to see the complete list in PubMed.