Precursor miRNA: hsa-mir-224

Precursor miRNA

Precursor Name hsa-mir-224
Genomic Location chrX:151958578-151958658 (-); nearby genomic features
Clustered miRNAs hsa-mir-224,hsa-mir-452 (within 10kb in genome)
NCBI GENE ID 407009
MIM ID 300769
miRBase ID MI0000301
Precursor Sequence 
       ca         u   u      a u   ug  u
gggcuuu  agucacuag ggu ccguuu g aga  au g
|||||||  ||||||||| ||| |||||| | |||  ||  u
cccgaaa  ucagugauc ccg gguaaa c uuu  ua g
       ca         -   u      a -   gu  c

Mature miRNA

Mature Name hsa-miR-224-5p
Previous Name hsa-miR-224
Mature Sequence 5' - ucaagucacuagugguuccguuuag - 3' (length = 25)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000281

References

  • [MiR-224-5p overexpression inhibits oxidative stress by regulating the PI3K/Akt/FoxO1 axis to attenuate hypoxia/reoxygenation-induced cardiomyocyte injury]. Liang G, Tang H, Guo C, Zhang M. Nan Fang Yi Ke Da Xue Xue Bao. 2024 Jun 20;44(6):1173-1181.

  • MiRNA-224-5p regulates the defective permeability barrier in sensitive skin by targeting claudin-5. Yang L, Wu WJ, Lyu LC, Tu Y, Gu H, Chen XF, Chai YJ, Man MQ, He L. Skin Res Technol. 2024 May;30(5):e13720.

  • [Le miR-224-5p régulé sert de biomarqueur pour l'insuffisance hépatique aiguë pédiatrique et régule l'inflammation en modulant ZBTB20]. Wang Q, Zhang G, Zhang M, Zhang Y, Ruan L, Hao H. Ann Biol Clin (Paris). 2024 Apr 19;82(1):70-80.

  • MiRNAs from the Dlk1-Dio3 locus and miR-224/452 cluster contribute to glioblastoma tumor heterogeneity. Smith CM, Catchpoole D, Hutvagner G. Sci Rep. 2024 Apr 13;14(1):8570.

  • miR-224-5p Attenuates Allergic Responses in Mice with Allergic Rhinitis by Modulating the Th1/Th2 Response. Li Y, An R, Wu M, He J, He X. Anal Cell Pathol (Amst). 2024 Feb 29;2024:5531970.

  • miR-224-5p acts as a tumour suppressor and reverses the resistance to BRAF inhibitor in melanoma through directly targeting PAK4 to block the MAPK pathway. Liu Y, Ruan H, Lu F, Peng H, Luan W. Pathol Res Pract. 2023 Sep;249:154772.

  • TAZ upregulates MIR-224 to inhibit oxidative stress response in multiple myeloma. Abegunde SO, Grieve S, Reiman T. Cancer Rep (Hoboken). 2023 Oct;6(10):e1879.

  • Knockdown of circSOD2 ameliorates osteoarthritis progression via the miR-224-5p/PRDX3 axis. Li H, Cao Y, Chang C, Huang W, Su S, Peng Z, Zhang J. J Orthop Surg Res. 2023 Jun 13;18(1):432.

  • Target gene repression mediated by miR-144 and miR-224 in cumulus cells is related to the success of oocyte Shafienia H, Montazeri F, Heydari L, Khalili MA, Mazloomzadeh S, Sheikhha MH, Biglari A. Reprod Fertil Dev. 2022 Oct;34(17):1089-1098.

  • Increased expression of miR-224-5p in circulating extracellular vesicles of patients with reduced coronary flow reserve. James K, Bryl-Gorecka P, Olde B, Gidlof O, Torngren K, Erlinge D. BMC Cardiovasc Disord. 2022 Jul 18;22(1):321.

  • Exosomal miR-224-5p from Colorectal Cancer Cells Promotes Malignant Transformation of Human Normal Colon Epithelial Cells by Promoting Cell Proliferation through Downregulation of CMTM4. Wu F, Yang J, Shang G, Zhang Z, Niu S, Liu Y, Liu H, Jing J, Fang Y. Oxid Med Cell Longev. 2022 Jun 30;2022:5983629.

  • Pentraxin 3 regulated by miR-224-5p modulates macrophage reprogramming and exacerbates osteoarthritis associated synovitis by targeting CD32. Yin J, Zeng H, Fan K, Xie H, Shao Y, Lu Y, Zhu J, Yao Z, Liu L, Zhang H, Luo B, Wang X, Zeng C, Bai X, Zhang H, Cai D. Cell Death Dis. 2022 Jun 24;13(6):567.

  • MiR-224 promotes lymphatic metastasis by targeting ANGPTL1 in non-small-cell lung carcinoma. Han H, Pan B, Liang F, Wu L, Liu X, Yang Y, Chen J. Cancer Biomark. 2022;34(3):431-441.

  • Abnormal expression of long non-coding RNA rhabdomyosarcoma 2-associated transcript (RMST) participates in the pathological mechanism of atherosclerosis by regulating miR-224-3p. Zhang T, Feng C, Zhang X, Sun B, Bian Y. Bioengineered. 2022 Feb;13(2):2648-2657.

  • Long non-coding RNA NORAD/miR-224-3p/MTDH axis contributes to CDDP resistance of esophageal squamous cell carcinoma by promoting nuclear accumulation of β-catenin. Jia Y, Tian C, Wang H, Yu F, Lv W, Duan Y, Cheng Z, Wang X, Wang Y, Liu T, Wang J, Liu L. Mol Cancer. 2021 Dec 10;20(1):162.

  • LncRNA LINC01094 contributes to glioma progression by modulating miR-224-5p/CHSY1 axis. Liu L, Xu Q, Xiong Y, Deng H, Zhou J. Hum Cell. 2022 Jan;35(1):214-225.

  • Hsa_circ_0001021 regulates intestinal epithelial barrier function via sponging miR-224-5p in ulcerative colitis. Li B, Li Y, Li L, Yu Y, Gu X, Liu C, Long X, Yu Y, Zuo X. Epigenomics. 2021 Sep;13(17):1385-1401.

  • MiR-224-5p Targeting OCLN Promotes the Proliferation, Migration, and Invasion of Clear Cell Renal Cell Carcinoma Cells. Liu Y, Nie H, Zhang Y, Zhang N, Han M, Liu H, Sun D, Wu X, Xiao X, Cao X. Urol Int. 2022;106(11):1185-1194.

  • Hsa_circ_0134111 promotes osteoarthritis progression by regulating miR-224-5p/CCL1 interaction. Liu Y, Zhang Y. Aging (Albany NY). 2021 Aug 19;13(16):20383-20394.

  • Serum miR-224, miR-760, miR-483-5p, miR-378 and miR-375 as potential novel biomarkers in rheumatoid arthritis. Abdelaleem OO, Fouad NA, Shaker OG, Ahmed TI, Abdelghaffar NK, Eid HM, Mohamed AA, Elebiary AM, Mohamed MM, Mahmoud RH. Int J Clin Pract. 2021 Nov;75(11):e14651.

    • There are 147 references associated with hsa-mir-224. Click here to see the complete list in PubMed.