Precursor miRNA: hsa-mir-206

Precursor miRNA

Precursor Name hsa-mir-206
Genomic Location chr6:52144349-52144434 (+); nearby genomic features
Clustered miRNAs hsa-mir-206,hsa-mir-133b (within 10kb in genome)
NCBI GENE ID 406989
MIM ID 611599
miRBase ID MI0000490
Precursor Sequence 
u    c                        cc     u g uu
 gcuu ccgaggccacaugcuucuuuauau  ccaua g a  a
 |||| ||||||||||||||||||||||||  ||||| | |  
 ugaa ggcuuuggugugugaaggaaugua  gguau c u  c
g    c                        -a     - g uu

Mature miRNA

Mature Name hsa-miR-206
Mature Sequence 5' - uggaauguaaggaagugugugg - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000462
Similar miRNAs hsa-miR-1-3p, hsa-miR-613 (sharing the same seed sequence with hsa-miR-206).

References

  • KLF4 Suppresses the Progression of Hepatocellular Carcinoma by Reducing Tumor ATP Synthesis through Targeting the Mir-206/RICTOR Axis. Wang Y, Zuo D, Huang Z, Qiu Y, Wu Z, Liu S, Zeng Y, Qiu Z, He W, Li B, Yuan Y, Niu Y, Qiu J. Int J Mol Sci. 2024 Jun 28;25(13):7165.

  • Biological functions of LncRNA SNHG14 in the development of thyroid cancer cells via targeting miR-206. Sang Y, Min R, Huang T, Zhang J. Cell Mol Biol (Noisy-le-grand). 2024 Apr 28;70(4):77-84.

  • Potential role of the lncRNA "HOTAIR"/miRNA "206"/BDNF network in the alteration in expression of synaptic plasticity gene arc and BDNF level in sera of patients with heroin use disorder through the PI3K/AKT/mTOR pathway compared to the controls. Khalifa FN, Hussein RF, Mekawy DM, Elwi HM, Alsaeed SA, Elnawawy Y, Shaheen SH. Mol Biol Rep. 2024 Feb 9;51(1):293.

  • FRS2 regulated by miR-429 and miR-206 promotes angiogenesis in osteosarcoma. Zhu Y, Liu Z, Cao L, Fan G, Ji R, Zhang L, Daji S, Zhu H, Wang Y, Zhou G. Gene. 2024 Mar 10;898:148118.

  • LncRNA HAGLROS contribute to papillary thyroid cancer progression by modulating miR-206/HMGA2 expression. Zeng Z, Tang S, Chen L, Hou H, Liu Y, Li J. Aging (Albany NY). 2023 Dec 18;15(24):14930-14944.

  • BAP31-Mediated miR-206/133b Cluster Promotes Transendothelial Migration and Metastasis of Colorectal Cancer. Zhang Q, Wang C, Wu Y, Liu J, Wang T, Wang B. Int J Mol Sci. 2023 Nov 25;24(23):16740.

  • A Comprehensive Review on the Importance of MiRNA-206 in the Animal Model and Human Diseases. Qi W, Guan W. Curr Neuropharmacol. 2024;22(6):1064-1079.

  • CCND2 and miR-206 as potential biomarkers in the clinical diagnosis of thyroid carcinoma by fine-needle aspiration cytology. Yuan S, Liu Z, Yu S, Wang X, Shi J. World J Surg Oncol. 2023 Jan 24;21(1):22.

  • MicroRNA-206 in human cancer: Mechanistic and clinical perspectives. Bahari Khasraghi L, Nouri M, Vazirzadeh M, Hashemipour N, Talebi M, Aghaei Zarch F, Majidpoor J, Kalhor K, Farnia P, Najafi S, Aghaei Zarch SM. Cell Signal. 2023 Jan;101:110525.

  • Circ_0008726 promotes malignant progression of ESCC cells through miR-206/HOXA13 pathway. Han T, Shi M, Chen G, Hao J. Gen Thorac Cardiovasc Surg. 2023 Jan;71(1):33-45.

  • microRNA-206 prevents hepatocellular carcinoma growth and metastasis via down-regulating CREB5 and inhibiting the PI3K/AKT signaling pathway. Chi Y, Gong Z, Xin H, Wang Z, Liu Z. Cell Cycle. 2022 Dec;21(24):2651-2663.

  • Diagnostic and Prognostic Value Analysis of miR-206 in Asymptomatic Carotid Artery Stenosis. Li D, Pan J. Br J Biomed Sci. 2022 Jul 6;79:10592.

  • lncRNA ADAMTS9-AS1/circFN1 Competitively Binds to miR-206 to Elevate the Expression of ACTB, Thus Inducing Hypertrophic Cardiomyopathy. Feng W, Han S. Oxid Med Cell Longev. 2022 Mar 31;2022:1450610.

  • Upregulated miR-206 Aggravates Deep Vein Thrombosis by Regulating GJA1-Mediated Autophagy of Endothelial Progenitor Cells. Li Y, Ge J, Yin Y, Yang R, Kong J, Gu J. Cardiovasc Ther. 2022 Mar 18;2022:9966306.

  • LncRNA SENCR overexpression attenuated the proliferation, migration and phenotypic switching of vascular smooth muscle cells in aortic dissection via the miR-206/myocardin axis. Song Y, Wang T, Mu C, Gui W, Deng Y, Ma R. Nutr Metab Cardiovasc Dis. 2022 Jun;32(6):1560-1570.

  • hsa-miR-206b Involves in the Development of Papillary Thyroid Carcinoma via Targeting LMX1B. Lu H, Zhu C, Ruan Y, Fan L, Ruan Z, Chen Q, Yuan J, Xu Y, Wang H, Wei Q. Biomed Res Int. 2022 Mar 15;2022:7488708.

  • Targeting of PFKFB3 with miR-206 but not mir-26b inhibits ovarian cancer cell proliferation and migration involving FAK downregulation. Boscaro C, Baggio C, Carotti M, Sandonà D, Trevisi L, Cignarella A, Bolego C. FASEB J. 2022 Mar;36(3):e22140.

  • LncRNA NEAT2 Modulates Pyroptosis of Renal Tubular Cells Induced by High Glucose in Diabetic Nephropathy (DN) by via miR-206 Regulation. El-Lateef AEA, El-Shemi AGA, Alhammady MS, Yuan R, Zhang Y. Biochem Genet. 2022 Oct;60(5):1733-1747.

  • lncRNA cytoskeleton regulator reduces non‑small cell lung cancer radiosensitivity by downregulating miRNA‑206 and activating prothymosin α. Jiang G, Yu H, Li Z, Zhang F. Int J Oncol. 2021 Nov;59(5):88.

  • Exosomes from Human Umbilical Vein Endothelial Cells Ameliorate Ischemic Injuries by Suppressing the RNA Component of Mitochondrial RNA-processing Endoribonuclease via the Induction of miR-206/miR-1-3p Levels. Zhong Y, Luo L. Neuroscience. 2021 Nov 10;476:34-44.

    • There are 230 references associated with hsa-mir-206. Click here to see the complete list in PubMed.