Precursor miRNA: hsa-mir-183

Precursor miRNA

Precursor Name hsa-mir-183
Genomic Location chr7:129774905-129775014 (-); nearby genomic features
Clustered miRNAs hsa-mir-182,hsa-mir-96,hsa-mir-183 (within 10kb in genome)
NCBI GENE ID 406959
MIM ID 611608
miRBase ID MI0000273
Precursor Sequence 
ccgcaga   u  ---c  -         g      --ac     ga        --   ac
       gug ga    uc cuguucugu uauggc    uggua  auucacug  uga  a
       ||| ||    || ||||||||| ||||||    |||||  ||||||||  |||  
       cac cu    ag gacgagaca auaccg    gccau  uaagugac  acu  g
-----ag   -  agac  a         a      ggaa     --        ug   cu

Mature miRNA

Mature Name hsa-miR-183-5p
Previous Name hsa-miR-183
Mature Sequence 5' - uauggcacugguagaauucacu - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000261

Mature miRNA

Mature Name hsa-miR-183-3p
Previous Name hsa-miR-183*
Mature Sequence 5' - gugaauuaccgaagggccauaa - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0004560

References

  • Investigating the interplay between the mir-183/182/96 cluster and the adherens junction pathway in early-stage breast cancer. Noun T, Kurdi A, Maatouk N, Talhouk R, Dohna HZ. Sci Rep. 2024 Oct 21;14(1):24711.

  • Publisher Correction: MiR-21 and miR-183 can simultaneously target SOCS6 and modulate growth and invasion of hepatocellular carcinoma (HCC) cells. Li ZB, Li ZZ, Li L, Chu HT, Jia M. Eur Rev Med Pharmacol Sci. 2024 May;28(9):3290.

  • Hsa_circ_0001402 alleviates vascular neointimal hyperplasia through a miR-183-5p-dependent regulation of vascular smooth muscle cell proliferation, migration, and autophagy. Lin JJ, Chen R, Yang LY, Gong M, Du MY, Mu SQ, Jiang ZA, Li HH, Yang Y, Wang XH, Wang SF, Liu KX, Cao SH, Wang ZY, Zhao AQ, Yang SY, Li C, Sun SG. J Adv Res. 2024 Jun;60:93-110.

  • MiR-183-5p promotes migration and invasion of prostate cancer by targeting TET1. Feng Y, Wang K, Qin M, Zhuang Q, Chen Z. BMC Urol. 2023 Jul 10;23(1):116.

  • Mir-183 functions as an oncogene via decreasing PTEN in breast cancer cells. Mohammaddoust S, Sadeghizadeh M. Sci Rep. 2023 May 19;13(1):8086.

  • The miR-183 Cluster: Biogenesis, Functions, and Cell Communication via Exosomes in Cancer. Li S, Meng W, Guo Z, Liu M, He Y, Li Y, Ma Z. Cells. 2023 May 5;12(9):1315.

  • Bile exosomal miR-182/183-5p increases cholangiocarcinoma stemness and progression by targeting HPGD and increasing PGE2 generation. Shu L, Li X, Liu Z, Li K, Shi A, Tang Y, Zhao L, Huang L, Zhang Z, Zhang D, Huang S, Lian S, Sheng G, Yan Z, Zhang Z, Xu Y. Hepatology. 2024 Feb 1;79(2):307-322.

  • Up-regulation of microRNA-183 reduces FOXO1 expression in gastric cancer patients with Helicobacter pylori infection. Qi C, Liu L, Wang J, Jin Y. Histol Histopathol. 2023 Nov;38(11):1349-1357.

  • Exosomes derived from human adipose-derived stem cells alleviate hepatic ischemia-reperfusion (I/R) injury through the miR-183/ALOX5 axis. Gong Y, Dai H, Liu W, Liao R, Chen H, Zhang L, Wang X, Chen Z. FASEB J. 2023 Mar;37(3):e22782.

  • MicroRNA-183-5p regulates TAR DNA-binding protein 43 neurotoxicity via SQSTM1/p62 in amyotrophic lateral sclerosis. Kim HC, Zhang Y, King PH, Lu L. J Neurochem. 2023 Mar;164(5):643-657.

  • Plasma miR-183-5p in colorectal cancer patients as potential predictive lymph node metastasis marker. Sanjabi F, Nekouian R, Akbari A, Mirzaei R, Fattahi A. J Cancer Res Ther. 2022 Jul-Sep;18(4):921-926.

  • The circ_FAM53B-miR-183-5p-CCDC6 axis modulates the malignant behaviors of papillary thyroid carcinoma cells. Zhang C, Gu H, Liu D, Tong F, Wei H, Zhou D, Fang J, Dai X, Tian H. Mol Cell Biochem. 2022 Nov;477(11):2627-2641.

  • Circular RNA_0057209 Acts as ceRNA to Inhibit Thyroid Cancer Progression by Promoting the STK4-Mediated Hippo Pathway Peng X, Zhu Y, Lin S, Yu W, Zhang C, Tan L, Long M, Luo D, Ji C. Oxid Med Cell Longev. 2022 Mar 11;2022:9974639.

  • Suppression of SIN3A by miR-183 Promotes Breast Cancer Metastasis. Davenport ML, Davis MR, Davenport BN, Crossman DK, Hall A, Pike J, Harada S, Hurst DR, Edmonds MD. Mol Cancer Res. 2022 Jun 3;20(6):883-894.

  • Downregulation of MUC15 by miR-183-5p.1 promotes liver tumor-initiating cells properties and tumorigenesis via regulating c-MET/PI3K/AKT/SOX2 axis. Han T, Zheng H, Zhang J, Yang P, Li H, Cheng Z, Xiang D, Wang R. Cell Death Dis. 2022 Mar 2;13(3):200.

  • miR-183 inhibits the viability, migration and invasion of epithelium on adenomyosis via targeting MMP-9. Wang Y, Chen L. J Gynecol Obstet Hum Reprod. 2022 Apr;51(4):102349.

  • miR-183-5p promotes proliferation, invasion, and glycolysis of thyroid carcinoma cells by targeting FOXO1. Han C, Mo K, Jiang L, Wang K, Teng L. Mol Cell Biochem. 2022 Apr;477(4):1195-1206.

  • Microvascular Barrier Protection by microRNA-183 via FoxO1 Repression: A Pathway Disturbed in Neuropathy and Complex Regional Pain Syndrome. Reinhold AK, Salvador E, Förster CY, Birklein F, Rittner HL. J Pain. 2022 Jun;23(6):967-980.

  • Identification of serum exosomal miR-98-5p, miR-183-5p, miR-323-3p and miR-19b-3p as potential biomarkers for glioblastoma patients and investigation of their mechanisms. Yang Q, Wei B, Peng C, Wang L, Li C. Curr Res Transl Med. 2022 Jan;70(1):103315.

  • ABAT targeted by miR-183-5p regulates cell functions in liver cancer. Han H, Zhou S, Chen G, Lu Y, Lin H. Int J Biochem Cell Biol. 2021 Dec;141:106116.

    • There are 169 references associated with hsa-mir-183. Click here to see the complete list in PubMed.