Precursor miRNA: hsa-mir-16-2

Precursor miRNA

Precursor Name hsa-mir-16-2
Genomic Location chr3:160404745-160404825 (+); nearby genomic features
Clustered miRNAs hsa-mir-15b,hsa-mir-16-2 (within 10kb in genome)
NCBI GENE ID 406951
miRBase ID MI0000115
Precursor Sequence 
  uc    cu         ua        c  ag   aau
gu  cacu  agcagcacg  aauauugg gu  uga   a
||  ||||  |||||||||  |||||||| ||  |||   
ca  guga  ucgucgugu  uuauaacc ca  auu   u
  gu    uu         ca        a  -a   aua

Mature miRNA

Mature Name hsa-miR-16-5p
Previous Name hsa-miR-16
Mature Sequence 5' - uagcagcacguaaauauuggcg - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000069
Similar miRNAs hsa-miR-15a-5p, hsa-miR-15b-5p, hsa-miR-195-5p, hsa-miR-424-5p, hsa-miR-497-5p, hsa-miR-6838-5p (sharing the same seed sequence with hsa-miR-16-5p).

Mature miRNA

Mature Name hsa-miR-16-2-3p
Previous Name hsa-miR-16-2*
Mature Sequence 5' - ccaauauuacugugcugcuuua - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0004518
Similar miRNAs hsa-miR-195-3p (sharing the same seed sequence with hsa-miR-16-2-3p).

References

  • Serum microRNAs as new biomarkers for detecting subclinical hemolysis in the nonacute phase of G6PD deficiency. Boonpeng K, Shibuta T, Hirooka Y, Kulkeaw K, Palasuwan D, Umemura T. Sci Rep. 2024 Jul 11;14(1):16029.

  • The mechanism and therapeutic potential of lncRNA MIR497HG/miR-16-5p axis in breast cancer. Cheng Q, Yu DY, Zhou YH, Huang JY. BMC Womens Health. 2024 Jul 2;24(1):379.

  • Predictive and Carcinogenic Roles of Necroptosis-Related miR-425-5p and miR-16-5p in Esophageal Squamous Cell Carcinoma. Zhidan X, Kedi X, Dan X, Xing S, Rui S. Ann Clin Lab Sci. 2024 Jan;54(1):76-85.

  • miR-16-5p aggravates sepsis-associated acute kidney injury by inducing apoptosis. Li H, Duan J, Zhang T, Fu Y, Xu Y, Miao H, Ge X. Ren Fail. 2024 Dec;46(1):2322688.

  • Circulating exosomal mir-16-2-3p is associated with coronary microvascular dysfunction in diabetes through regulating the fatty acid degradation of endothelial cells. Liu Y, Zhong C, Chen S, Xue Y, Wei Z, Dong L, Kang L. Cardiovasc Diabetol. 2024 Feb 9;23(1):60.

  • CircMACF1 alleviates myocardial fibrosis after acute myocardial infarction by suppressing cardiac fibroblast activation via the miR-16-5p/SMAD7 axis. Wang Y, Liu Y, Fei A, Tan L. Medicine (Baltimore). 2023 Sep 15;102(37):e35119.

  • Urinary miR-16-5p can be used as a potential marker of endocapillary hypercellularity in IgA nephropathy. Zhang M, Duan ZY, Zhang QY, Xu XG, Zhang Y, Wang P, Duan SW, Wu J, Chen XM, Cai GY. Sci Rep. 2023 Apr 13;13(1):6048.

  • The Molecular Mechanisms and Function of miR-15a/16 Dysregulation in Fibrotic Diseases. Wen D, Zhang H, Zhou Y, Wang J. Int J Mol Sci. 2022 Dec 16;23(24):16041.

  • Non-canonical miRNA-RNA base-pairing impedes tumor suppressor activity of miR-16. Quéméner AM, Bachelot L, Aubry M, Avner S, Leclerc D, Salbert G, Cabillic F, Decaudin D, Mari B, Mouriaux F, Galibert MD, Gilot D. Life Sci Alliance. 2022 Oct 6;5(12):e202201643.

  • Study of the role of microRNAs 16 and 135a in patients with lifelong premature ejaculation receiving fluoxetine daily for 3 months: A prospective case control study. GamalEl Din SF, Motawi AT, Rashed LA, Elghobary H, Saad HM, Ismail MM, Abdel-Latif HF. Andrologia. 2022 Nov;54(10):e14549.

  • Circulating miRNA-16 in inflammatory bowel disease and some clinical correlations - a cohort study in Bulgarian patients. Atanassova A, Georgieva A. Eur Rev Med Pharmacol Sci. 2022 Sep;26(17):6310-6315.

  • MicroRNA-16 Represses TGF-β1-induced Epithelial-to-Mesenchymal Transition in Human Lung Adenocarcinoma Cell Line. Rajasekaran S, Mishra S, Gandhi D. Microrna. 2022;11(3):206-215.

  • microRNA-16-5p suppresses cell proliferation and angiogenesis in colorectal cancer by negatively regulating forkhead box K1 to block the PI3K/Akt/mTOR pathway. Huang X, Xu X, Ke H, Pan X, Ai J, Xie R, Lan G, Hu Y, Wu Y. Eur J Histochem. 2022 May 10;66(2):3333.

  • miR-16-5p Suppression Protects Human Cardiomyocytes against Endoplasmic Reticulum and Oxidative Stress-Induced Injury. Toro R, Pérez-Serra A, Mangas A, Campuzano O, Sarquella-Brugada G, Quezada-Feijoo M, Ramos M, Alcalá M, Carrera E, García-Padilla C, Franco D, Bonet F. Int J Mol Sci. 2022 Jan 18;23(3):1036.

  • circUSP34 accelerates osteosarcoma malignant progression by sponging miR-16-5p. Lou J, Zhang H, Xu J, Ren T, Huang Y, Tang X, Guo W. Cancer Sci. 2022 Jan;113(1):120-131.

  • Long non-coding RNA LINC00649 regulates YES-associated protein 1 (YAP1)/Hippo pathway to accelerate gastric cancer (GC) progression via sequestering miR-16-5p. Wang H, Di X, Bi Y, Sun S, Wang T. Bioengineered. 2021 Dec;12(1):1791-1802.

  • LINC00649 Facilitates the Cellular Process of Bladder Cancer Cells via Signaling Axis miR-16-5p/JARID2. Liu Y, Huang X, Guo L, Luo N. Urol Int. 2022;106(3):304-312.

  • The Predictive Value of miR-16, -29a and -134 for Early Identification of Gestational Diabetes: A Nested Analysis of the DALI Cohort. Sørensen AE, van Poppel MNM, Desoye G, Damm P, Simmons D, Jensen DM, Dalgaard LT; The DALI Core Investigator Group. Cells. 2021 Jan 15;10(1):170.

  • MiR-16-5p suppresses myofibroblast activation in systemic sclerosis by inhibiting NOTCH signaling. Yao Q, Xing Y, Wang Z, Liang J, Lin Q, Huang M, Chen Y, Lin B, Xu X, Chen W. Aging (Albany NY). 2020 Dec 19;13(2):2640-2654.

  • A comparison between the effects of over-expression of miRNA-16 and miRNA-34a on cell cycle progression of mesothelioma cell lines and on their cisplatin sensitivity. Pinelli S, Alinovi R, Corradi M, Poli D, Cavallo D, Pelosi G, Ampollini L, Goldoni M, Mozzoni P. Cancer Treat Res Commun. 2021;26:100276.

    • There are 107 references associated with hsa-mir-16-2. Click here to see the complete list in PubMed.