Precursor miRNA: hsa-mir-154



Precursor miRNA

Precursor Name hsa-mir-154
Genomic Location chr14:101059755-101059838 (+); nearby genomic features
Clustered miRNAs hsa-mir-487a,hsa-mir-382,hsa-mir-134,hsa-mir-668,hsa-mir-485,hsa-mir-323b,hsa-mir-154,hsa-mir-496,hsa-mir-377,hsa-mir-541,hsa-mir-409,hsa-mir-412,hsa-mir-369,hsa-mir-410,hsa-mir-656 (within 10kb in genome)
NCBI GENE ID 406946
miRBase ID MI0000480
Precursor Sequence
g       u            u      ugcc    - uuu
 ugguacu gaagauagguua ccgugu    uucg c   a
 ||||||| |||||||||||| ||||||    |||| |    u
 accauga uuuuuauccagu ggcaca    aagc g   u
a       c            u      uacu    a ugu

Mature miRNA

Mature Name hsa-miR-154-5p
Previous Name hsa-miR-154
Mature Sequence 5' - uagguuauccguguugccuucg - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000452

Mature miRNA

Mature Name hsa-miR-154-3p
Previous Name hsa-miR-154*
Mature Sequence 5' - aaucauacacgguugaccuauu - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000453
Similar miRNAs hsa-miR-487a-3p (sharing the same seed sequence with hsa-miR-154-3p).

References


  • MicroRNA-154-5p suppresses cervical carcinoma growth and metastasis by silencing Cullin2 Li Y, Wei Y, Zhang H, Bai Y, Wang X, Li Q, Liu Y, Wang S, Wang J, Wen S, Li J, Zhao W. PeerJ. 2023 Jun 27;11:e15641.

  • LncRNA KCNQ10T1 shuttled by bone marrow mesenchymal stem cell-derived exosome inhibits sepsis via regulation of miR-154-3p/RNF19A axis. Yuan H, Yu J, Liu C, Zhao H, Xue J, Liu J, Yang Y. Cell Tissue Res. 2023 Sep;393(3):507-521.

  • Exosomes-derived miR-154-5p attenuates esophageal squamous cell carcinoma progression and angiogenesis by targeting kinesin family member 14. Shou Y, Wang X, Liang Y, Liu X, Chen K. Bioengineered. 2022 Feb;13(2):4610-4620.

  • Circ-ATAD1 is overexpressed in osteosarcoma (OS) and suppresses the maturation of miR-154-5p to increase cell invasion and migration. Zhou J, Xu L, Yang P, Lin S, Huang H. J Orthop Surg Res. 2021 Dec 2;16(1):699.

  • lncRNA DLGAP1-AS2 Knockdown Inhibits Hepatocellular Carcinoma Cell Migration and Invasion by Regulating miR-154-5p Methylation. Chen K, Zhang Z, Yu A, Li J, Liu J, Zhang X. Biomed Res Int. 2020 Oct 9;2020:6575724.

  • SP1 activated-lncRNA SNHG1 mediates the development of epilepsy via miR-154-5p/TLR5 axis. Zhao MW, Qiu WJ, Yang P. Epilepsy Res. 2020 Dec;168:106476.

  • Circular RNA circABCC4 acts as a ceRNA of miR-154-5p to improve cell viability, migration and invasion of breast cancer cells in vitro. Jiang J, Cheng X. Cell Cycle. 2020 Oct;19(20):2653-2661.

  • Histone deacetylase 1 regulates the malignancy of oral cancer cells via miR-154-5p/PCNA axis. Lv Y, Lu J, Liu X, Miao S, Mao X, Li B, Pei R, Xiang C. Biol Chem. 2020 Oct 25;401(11):1273-1281.

  • Long non-coding RNA SNHG11 promotes cell proliferation, invasion and migration in glioma by targeting miR-154-5p. Geng YB, Xu C, Wang Y, Zhang LW. Eur Rev Med Pharmacol Sci. 2020 May;24(9):4901-4908.

  • Long intergenic non-coding RNA 1939 eliminates proliferation and migration of human renal cell carcinoma (RCC) cells by down-regulation of miR-154. Zhang R, Zhang W, Xu B, Lv C, Hou J, Zhang G. Artif Cells Nanomed Biotechnol. 2020 Dec;48(1):695-702.

  • Upregulation of miRNA-154-5p prevents the tumorigenesis of osteosarcoma. Tian Q, Gu Y, Wang F, Zhou L, Dai Z, Liu H, Wu X, Wang X, Liu Y, Chen S, Han Q. Biomed Pharmacother. 2020 Apr;124:109884.

  • Correlation between serum miR-154-5p and urinary albumin excretion rates in patients with type 2 diabetes mellitus: a cross-sectional cohort study. Ren H, Wu C, Shao Y, Liu S, Zhou Y, Wang Q. Front Med. 2020 Oct;14(5):642-650.

  • Circ_101064 regulates the proliferation, invasion and migration of glioma cells through miR-154-5p/ PIWIL1 axis. Zhou H, Zhang Y, Lai Y, Xu C, Cheng Y. Biochem Biophys Res Commun. 2020 Mar 12;523(3):608-614.

  • miR-154-3p and miR-487-3p synergistically modulate RHOA signaling in the carcinogenesis of thyroid cancer. Fan XD, Luo Y, Wang J, An N. Biosci Rep. 2020 Jan 31;40(1):BSR20193158.

  • MicroRNA-154 Targets the Wnt/β-Catenin Signaling Pathway Following Injury to Human Vascular Endothelial Cells by Hydrogen Peroxide. Li Y, Meng R. Med Sci Monit. 2019 Jul 30;25:5648-5656.

  • MiR-154 inhibits cells proliferation and metastasis in melanoma by targeting AURKA and serves as a novel prognostic indicator. Wang J, Fang Y, Liu YF, Wang X, Wang XL, Wang RY, Meng ZD. Eur Rev Med Pharmacol Sci. 2019 May;23(10):4275-4284.

  • Differential expression of circulating miRNAs as a novel tool to assess BAG3-associated familial dilated cardiomyopathy. Zaragoza C, Saura M, Hernández I, Ramirez-Carracedo R, García-García F, Zamorano JL, Mangas A, Toro R. Biosci Rep. 2019 Mar 15;39(3):BSR20180934.

  • MicroRNA‑154 functions as a tumor suppressor in bladder cancer by directly targeting ATG7. Zhang J, Mao S, Wang L, Zhang W, Zhang Z, Guo Y, Wu Y, Yi F, Yao X. Oncol Rep. 2019 Feb;41(2):819-828.

  • The long noncoding RNA SNHG1 regulates colorectal cancer cell growth through interactions with EZH2 and miR-154-5p. Xu M, Chen X, Lin K, Zeng K, Liu X, Pan B, Xu X, Xu T, Hu X, Sun L, He B, Pan Y, Sun H, Wang S. Mol Cancer. 2018 Sep 28;17(1):141.

  • Oncogene miR-154-5p regulates cellular function and acts as a molecular marker with poor prognosis in renal cell carcinoma. Lin C, Li Z, Chen P, Quan J, Pan X, Zhao L, Zhou L, Lai Y, He T, Xu W, Xu J, Guan X, Li H, Yang S, Hu Y, Lai Y. Life Sci. 2018 Sep 15;209:481-489.


  • There are 46 references associated with hsa-mir-154. Click here to see the complete list in PubMed.