Precursor miRNA: hsa-mir-153-2

Precursor miRNA

Precursor Name hsa-mir-153-2
Genomic Location chr7:157574336-157574422 (-); nearby genomic features
NCBI GENE ID 406945
miRBase ID MI0000464
Precursor Sequence 
a     gg      -             gu       -a  aa
 gcggu  ccagug ucauuuuugugau  ugcagcu  gu  u
 |||||  |||||| |||||||||||||  |||||||  ||   a
 uguca  gguuac agugaaaacacug  acguuga  cg  u
g     aa      u             au       cc  ag

Mature miRNA

Mature Name hsa-miR-153-3p
Mature Sequence 5' - uugcauagucacaaaagugauc - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000439

References

  • The study of Rahimi S, Rezvani N, Khazayel S, Jalilian N, Shakiba E, Khadir F, Yari K, Rahimi Z. Epigenomics. 2024 Mar;16(6):389-401.

  • LncRNA TEX41 promotes the proliferation and migration of squamous cell carcinoma cells by upregulating Atg5 via sponging miR-153-3p. Yang W, Chen Y. Cell Mol Biol (Noisy-le-grand). 2023 Dec 20;69(14):248-254.

  • miR-153-3p inhibited osteogenic differentiation of human DPSCs through CBFβ signaling. Wei C, Chu M, Zheng K, He P, Xiao J. In Vitro Cell Dev Biol Anim. 2022 Apr;58(4):316-324.

  • [Mechanism of circZNF609 targeting miR-153 to regulate the proliferation and apoptosis of diffuse large B-cell lymphoma]. Yang CS, Lou Y, Ke QP, Xu XJ, Zhang Y. Zhonghua Zhong Liu Za Zhi. 2022 Mar 23;44(3):238-245.

  • Implication of miRNA-153 on PTEN expression in prostatic adenocarcinoma. Aboushousha T, El-Nahas EI, El-Hindawi A, Elwi D, El-Ganzouri H, Hammam O, Magdy M, Helal NS. Eur Rev Med Pharmacol Sci. 2021 Nov;25(22):6834-6843.

  • MicroRNA‑153‑3p suppresses retinoblastoma cell growth and invasion via targeting the IGF1R/Raf/MEK and IGF1R/PI3K/AKT signaling pathways. Guo L, Bai Y, Ni T, Li Y, Cao R, Ji S, Li S. Int J Oncol. 2021 Jul;59(1):47.

  • Role of miR153 and miR455-5p Expression in Oral Squamous Cell Carcinoma Isolated from Plasma. Baber S, Bayat M, Mohamadnia A, Shamshiri A, Amini Shakib P, Bahrami N. Asian Pac J Cancer Prev. 2021 Jan 1;22(1):157-161.

  • Hsa_circ_0008537 facilitates liver carcinogenesis by upregulating MCL1 and Snail1 expression via miR‑153‑3p. Yang G, Li X, Liu J, Huang S, Weng Y, Zhu J, Lin D, Jiang O. Oncol Rep. 2021 Mar;45(3):1072-1082.

  • LncRNA FGD5-AS1 promotes tumor growth by regulating MCL1 via sponging miR-153-3p in oral cancer. Ge C, Dong J, Chu Y, Cao S, Zhang J, Wei J. Aging (Albany NY). 2020 Jul 16;12(14):14355-14364.

  • Downregulation of NEAT1 Suppresses Cell Proliferation, Migration, and Invasion in NSCLC Via Sponging miR-153-3p. Zhao L, Bi M, Zhang H, Shi M. Cancer Biother Radiopharm. 2020 Jun;35(5):362-370.

  • Long noncoding RNA Jiang Y, Wu K, Cao W, Xu Q, Wang X, Qin X, Wang X, Li Y, Zhang J, Chen W. Epigenomics. 2020 Mar;12(6):487-505.

  • MicroRNA-153-3p regulates cell proliferation and cisplatin resistance via Nrf-2 in esophageal squamous cell carcinoma. Zuo J, Zhao M, Fan Z, Liu B, Wang Y, Li Y, Lv P, Xing L, Zhang X, Shen H. Thorac Cancer. 2020 Mar;11(3):738-747.

  • Salivary microR-153 and microR-223 Levels as Potential Diagnostic Biomarkers of Idiopathic Parkinson's Disease. Cressatti M, Juwara L, Galindez JM, Velly AM, Nkurunziza ES, Marier S, Canie O, Gornistky M, Schipper HM. Mov Disord. 2020 Mar;35(3):468-477.

  • Upregulated circ_0005576 facilitates cervical cancer progression via the miR-153/KIF20A axis. Ma H, Tian T, Liu X, Xia M, Chen C, Mai L, Xie S, Yu L. Biomed Pharmacother. 2019 Oct;118:109311.

  • Long non-coding RNA ROR regulated ABCB1 to induce cisplatin resistance in osteosarcoma by sponging miR-153-3p. Cheng FH, Zhao ZS, Liu WD. Eur Rev Med Pharmacol Sci. 2019 Sep;23(17):7256-7265.

  • MiRNA-153-3p promotes gefitinib-sensitivity in non-small cell lung cancer by inhibiting ATG5 expression and autophagy. Zhang W, Dong YZ, Du X, Peng XN, Shen QM. Eur Rev Med Pharmacol Sci. 2019 Mar;23(6):2444-2452.

  • Molecular mechanism of miR-153 inhibiting migration, invasion and epithelial-mesenchymal transition of breast cancer by regulating transforming growth factor beta (TGF-β) signaling pathway. Wang J, Liang S, Duan X. J Cell Biochem. 2019 Jun;120(6):9539-9546.

  • LncRNA CDKN2BAS predicts poor prognosis in patients with hepatocellular carcinoma and promotes metastasis via the miR-153-5p/ARHGAP18 signaling axis. Chen J, Huang X, Wang W, Xie H, Li J, Hu Z, Zheng Z, Li H, Teng L. Aging (Albany NY). 2018 Nov 29;10(11):3371-3381.

  • miR-153 enhances the therapeutic effect of gemcitabine by targeting Snail in pancreatic cancer. Liu F, Liu B, Qian J, Wu G, Li J, Ma Z. Acta Biochim Biophys Sin (Shanghai). 2017 Jun 1;49(6):520-529.

  • Knockdown of Long Noncoding RNA TUG1 Inhibits the Proliferation and Cellular Invasion of Osteosarcoma Cells by Sponging miR-153. Wang H, Yu Y, Fan S, Luo L. Oncol Res. 2018 Jun 11;26(5):665-673.

    • There are 36 references associated with hsa-mir-153-2. Click here to see the complete list in PubMed.