Mature miRNA: hsa-miR-153-3p

Mature miRNA

miRNA Name hsa-miR-153-3p
miRNA Sequence 5' - uugcauagucacaaaagugauc - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000439

Precursor miRNA

Precursor Name hsa-mir-153-1
Genomic Location chr2:219294111-219294200 (-); nearby genomic features
NCBI GENE ID 406944
miRBase ID MI0000463
Precursor Sequence 
c     g         -             -c       --   au
 ucaca cugccagug ucauuuuugugau  ugcagcu  agu  u
 ||||| ||||||||| |||||||||||||  |||||||  |||  
 ggugu gacgguuac agugaaaacacug  acguuga  uca  c
c     g         u             au       cc   cu
Precursor Name hsa-mir-153-2
Genomic Location chr7:157574336-157574422 (-); nearby genomic features
NCBI GENE ID 406945
miRBase ID MI0000464
Precursor Sequence 
a     gg      -             gu       -a  aa
 gcggu  ccagug ucauuuuugugau  ugcagcu  gu  u
 |||||  |||||| |||||||||||||  |||||||  ||   a
 uguca  gguuac agugaaaacacug  acguuga  cg  u
g     aa      u             au       cc  ag

References

  • The study of Rahimi S, Rezvani N, Khazayel S, Jalilian N, Shakiba E, Khadir F, Yari K, Rahimi Z. Epigenomics. 2024 Mar;16(6):389-401.

  • LncRNA TEX41 promotes the proliferation and migration of squamous cell carcinoma cells by upregulating Atg5 via sponging miR-153-3p. Yang W, Chen Y. Cell Mol Biol (Noisy-le-grand). 2023 Dec 20;69(14):248-254.

  • Secreted miR-153 Controls Proliferation and Invasion of Higher Gleason Score Prostate Cancer. Bertoli G, Panio A, Cava C, Gallivanone F, Alini M, Strano G, Molfino F, Brioschi L, Viani P, Porro D. Int J Mol Sci. 2022 Jun 6;23(11):6339.

  • miR-153-3p inhibited osteogenic differentiation of human DPSCs through CBFβ signaling. Wei C, Chu M, Zheng K, He P, Xiao J. In Vitro Cell Dev Biol Anim. 2022 Apr;58(4):316-324.

  • [Mechanism of circZNF609 targeting miR-153 to regulate the proliferation and apoptosis of diffuse large B-cell lymphoma]. Yang CS, Lou Y, Ke QP, Xu XJ, Zhang Y. Zhonghua Zhong Liu Za Zhi. 2022 Mar 23;44(3):238-245.

  • LncRNA miR-17-92a-1 cluster host gene (MIR17HG) promotes neuronal damage and microglial activation by targeting the microRNA-153-3p/alpha-synuclein axis in Parkinson's disease. Zhang J, Yang Y, Zhou C, Zhu R, Xiao X, Zhou B, Wan D. Bioengineered. 2022 Feb;13(2):4493-4516.

  • Implication of miRNA-153 on PTEN expression in prostatic adenocarcinoma. Aboushousha T, El-Nahas EI, El-Hindawi A, Elwi D, El-Ganzouri H, Hammam O, Magdy M, Helal NS. Eur Rev Med Pharmacol Sci. 2021 Nov;25(22):6834-6843.

  • Hsa-circ_0058106 induces EMT and metastasis in laryngeal cancer via sponging miR-153 and inducing Twist1 nuclear translocation. Zhang X, Wu N, Wang J. Cell Oncol (Dordr). 2021 Dec;44(6):1373-1386.

  • MicroRNA‑153‑3p suppresses retinoblastoma cell growth and invasion via targeting the IGF1R/Raf/MEK and IGF1R/PI3K/AKT signaling pathways. Guo L, Bai Y, Ni T, Li Y, Cao R, Ji S, Li S. Int J Oncol. 2021 Jul;59(1):47.

  • CircATRNL1 protects against osteoarthritis by targeting miR-153-3p and KLF5. Wang KF, Shi ZW, Dong DM. Int Immunopharmacol. 2021 Jul;96:107704.

  • Role of miR153 and miR455-5p Expression in Oral Squamous Cell Carcinoma Isolated from Plasma. Baber S, Bayat M, Mohamadnia A, Shamshiri A, Amini Shakib P, Bahrami N. Asian Pac J Cancer Prev. 2021 Jan 1;22(1):157-161.

  • Hsa_circ_0008537 facilitates liver carcinogenesis by upregulating MCL1 and Snail1 expression via miR‑153‑3p. Yang G, Li X, Liu J, Huang S, Weng Y, Zhu J, Lin D, Jiang O. Oncol Rep. 2021 Mar;45(3):1072-1082.

  • lncRNA KCNQ1OT1 promotes the proliferation, migration and invasion of retinoblastoma cells by upregulating HIF-1α via sponging miR-153-3p. Wang Y, Wang J, Hao H, Luo X. J Investig Med. 2020 Dec;68(8):1349-1356.

  • Long non-coding RNA LINC00858 promotes cells proliferation and invasion through the miR-153-3p/Rabl3 axis in hepatocellular carcinoma. Qi WY, Mao XB, He YB, Xiao CH. Eur Rev Med Pharmacol Sci. 2020 Sep;24(18):9343-9352.

  • LncRNA FGD5-AS1 promotes tumor growth by regulating MCL1 via sponging miR-153-3p in oral cancer. Ge C, Dong J, Chu Y, Cao S, Zhang J, Wei J. Aging (Albany NY). 2020 Jul 16;12(14):14355-14364.

  • MiR-153-5p promotes sensibility of colorectal cancer cells to oxaliplatin via targeting Bcl-2-mediated autophagy pathway. He Y, Zhang L, Tan F, Wang LF, Liu DH, Wang RJ, Yin XZ. Biosci Biotechnol Biochem. 2020 Aug;84(8):1645-1651.

  • Downregulation of NEAT1 Suppresses Cell Proliferation, Migration, and Invasion in NSCLC Via Sponging miR-153-3p. Zhao L, Bi M, Zhang H, Shi M. Cancer Biother Radiopharm. 2020 Jun;35(5):362-370.

  • Long noncoding RNA Jiang Y, Wu K, Cao W, Xu Q, Wang X, Qin X, Wang X, Li Y, Zhang J, Chen W. Epigenomics. 2020 Mar;12(6):487-505.

  • OIP5-AS1 promotes the progression of gastric cancer cells via the miR-153-3p/ZBTB2 axis. Zhi XH, Jiang K, Ma YY, Zhou LQ. Eur Rev Med Pharmacol Sci. 2020 Mar;24(5):2428-2441.

  • MicroRNA-153-3p regulates cell proliferation and cisplatin resistance via Nrf-2 in esophageal squamous cell carcinoma. Zuo J, Zhao M, Fan Z, Liu B, Wang Y, Li Y, Lv P, Xing L, Zhang X, Shen H. Thorac Cancer. 2020 Mar;11(3):738-747.

    • There are 66 references associated with hsa-miR-153-3p. Click here to see the complete list in PubMed.