Precursor miRNA: hsa-mir-105-1

Precursor miRNA

Precursor Name hsa-mir-105-1
Genomic Location chrX:152392219-152392299 (-); nearby genomic features
Clustered miRNAs hsa-mir-105-1,hsa-mir-767,hsa-mir-105-2 (within 10kb in genome)
NCBI GENE ID 406897
MIM ID 300811
miRBase ID MI0000111
Precursor Sequence 
ugu         u  a          uc        g ug
   gcaucgugg ca augcucagac  cuguggug c  c
   ||||||||| || ||||||||||  |||||||| |   u
   uguggcauc gu uacgaguuug  ggcaccac g  c
auc         -  g          ua        - ua

Mature miRNA

Mature Name hsa-miR-105-5p
Previous Name hsa-miR-105
Mature Sequence 5' - ucaaaugcucagacuccuguggu - 3' (length = 23)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000102
Similar miRNAs hsa-miR-7853-5p (sharing the same seed sequence with hsa-miR-105-5p).

Mature miRNA

Mature Name hsa-miR-105-3p
Previous Name hsa-miR-105*
Mature Sequence 5' - acggauguuugagcaugugcua - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0004516

References

  • Circular RNA circMRPS35 represses malignant progression in osteosarcoma cells via targeting miR-105-5p/FOXO1. Jiang C, Jiang Z, Zhang X. Aging (Albany NY). 2024 Aug 5;16(15):11568-11576.

  • Exosomal miR-105-5p derived from bladder cancer stem cells targets for GPR12 to promote the malignancy of bladder cancer. Pan G, Jiang B, Yi Z, Yin J, Liu Y. BMC Urol. 2023 Oct 3;23(1):155.

  • miR-105-5p regulates PD-L1 expression and tumor immunogenicity in gastric cancer. Miliotis C, Slack FJ. Cancer Lett. 2021 Oct 10;518:115-126.

  • Role of hsa‑miR‑105 during the pathogenesis of paclitaxel resistance and its clinical implication in ovarian cancer. Li M, Zhang S, Ma Y, Yang Y, An R. Oncol Rep. 2021 May;45(5):84.

  • MiR-105 enhances osteogenic differentiation of hADSCs via the targeted regulation of SOX9. Li CL, Wang K, Li ZW, Xiong YB, Liu JH, Meng GH, Qin F. Tissue Cell. 2021 Oct;72:101540.

  • MiR-105-3p acts as an oncogene to promote the proliferation and metastasis of breast cancer cells by targeting GOLIM4. Lin B, Liu C, Shi E, Jin Q, Zhao W, Wang J, Ji R. BMC Cancer. 2021 Mar 15;21(1):275.

  • Hsa-miR-105-1 Regulates Cisplatin-Resistance in Ovarian Carcinoma Cells by Targeting ANXA9. Kou X, Ding H, Li L, Chao H. Anal Cell Pathol (Amst). 2021 Feb 24;2021:6662486.

  • Cancer-secreted miRNAs regulate amino-acid-induced mTORC1 signaling and fibroblast protein synthesis. Fong MY, Yan W, Ghassemian M, Wu X, Zhou X, Cao M, Jiang L, Wang J, Liu X, Zhang J, Wang SE. EMBO Rep. 2021 Feb 3;22(2):e51239.

  • Knockdown of long non-coding RNA VIM-AS1 inhibits glioma cell proliferation and migration, and increases the cell apoptosis via modulation of WEE1 targeted by miR-105-5p. Suo ST, Gong P, Peng XJ, Niu D, Guo YT. Eur Rev Med Pharmacol Sci. 2020 Jun;24(12):6834-6847.

  • MicroRNA-105 plays an independent prognostic role in esophageal cancer and acts as an oncogene. Gao R, Wang Z, Liu Q, Yang C. Cancer Biomark. 2020;27(2):173-180.

  • MiR-105 inhibits gastric cancer cells metastasis, epithelial-mesenchymal transition by targeting SOX9. Shang JC, Yu GZ, Ji ZW, Wang XQ, Xia L. Eur Rev Med Pharmacol Sci. 2019 Jul;23(14):6160-6169.

  • Up-regulation of miRNA-105 inhibits the progression of gastric carcinoma by directly targeting SOX9. Jin M, Zhang GW, Shan CL, Zhang H, Wang ZG, Liu SQ, Wang SQ. Eur Rev Med Pharmacol Sci. 2019 May;23(9):3779-3789.

  • Cancer-cell-secreted exosomal miR-105 promotes tumour growth through the MYC-dependent metabolic reprogramming of stromal cells. Yan W, Wu X, Zhou W, Fong MY, Cao M, Liu J, Liu X, Chen CH, Fadare O, Pizzo DP, Wu J, Liu L, Liu X, Chin AR, Ren X, Chen Y, Locasale JW, Wang SE. Nat Cell Biol. 2018 May;20(5):597-609.

  • DNMT3A-mediated down-regulation of microRNA-105 promotes gastric cancer cell proliferation. Zhou GQ, Han F, Shi ZL, Yu L, Li XF, Yu C, Shen CL, Wan DW, Zhu XG, Li R, He SB. Eur Rev Med Pharmacol Sci. 2017 Aug;21(15):3377-3383.

  • High expression of miR-105-1 positively correlates with clinical prognosis of hepatocellular carcinoma by targeting oncogene NCOA1. Ma YS, Wu TM, Lv ZW, Lu GX, Cong XL, Xie RT, Yang HQ, Chang ZY, Sun R, Chai L, Cai MX, Zhong XJ, Zhu J, Fu D. Oncotarget. 2017 Feb 14;8(7):11896-11905.

  • Novel MicroRNA Regulators of Atrial Natriuretic Peptide Production. Wu C, Arora P, Agha O, Hurst LA, Allen K, Nathan DI, Hu D, Jiramongkolchai P, Smith JG, Melander O, Trenson S, Janssens SP, Domian I, Wang TJ, Bloch KD, Buys ES, Bloch DB, Newton-Cheh C. Mol Cell Biol. 2016 Jun 29;36(14):1977-87.

  • miR-105/Runx2 axis mediates FGF2-induced ADAMTS expression in osteoarthritis cartilage. Ji Q, Xu X, Xu Y, Fan Z, Kang L, Li L, Liang Y, Guo J, Hong T, Li Z, Zhang Q, Ye Q, Wang Y. J Mol Med (Berl). 2016 Jun;94(6):681-94.

  • MicroRNA-105 suppresses cell proliferation and inhibits PI3K/AKT signaling in human hepatocellular carcinoma. Shen G, Rong X, Zhao J, Yang X, Li H, Jiang H, Zhou Q, Ji T, Huang S, Zhang J, Jia H. Carcinogenesis. 2014 Dec;35(12):2748-55.

  • Cancer-secreted miR-105 destroys vascular endothelial barriers to promote metastasis. Zhou W, Fong MY, Min Y, Somlo G, Liu L, Palomares MR, Yu Y, Chow A, O'Connor ST, Chin AR, Yen Y, Wang Y, Marcusson EG, Chu P, Wu J, Wu X, Li AX, Li Z, Gao H, Ren X, Boldin MP, Lin PC, Wang SE. Cancer Cell. 2014 Apr 14;25(4):501-15.

  • MicroRNA screen of human embryonic stem cell differentiation reveals miR-105 as an enhancer of megakaryopoiesis from adult CD34+ cells. Kamat V, Paluru P, Myint M, French DL, Gadue P, Diamond SL. Stem Cells. 2014 May;32(5):1337-46.

    • There are 27 references associated with hsa-mir-105-1. Click here to see the complete list in PubMed.