Precursor miRNA: hsa-let-7f-1

Precursor miRNA

Precursor Name hsa-let-7f-1
Genomic Location chr9:94176347-94176433 (+); nearby genomic features
Clustered miRNAs hsa-let-7a-1,hsa-let-7f-1,hsa-let-7d (within 10kb in genome)
NCBI GENE ID 406888
MIM ID 612146
miRBase ID MI0000067
Precursor Sequence 
    a ug                      ---------       u
ucag g  agguaguagauuguauaguugu         gggguag g
|||| |  ||||||||||||||||||||||         |||||||  a
aguc c  uccguuaucuaacauaucaaua         ucccauu u
    - cu                      gaggacuug       u

Mature miRNA

Mature Name hsa-let-7f-5p
Previous Name hsa-let-7f
Mature Sequence 5' - ugagguaguagauuguauaguu - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000067
Similar miRNAs hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7c-5p, hsa-let-7d-5p, hsa-let-7e-5p, hsa-let-7g-5p, hsa-let-7i-5p, hsa-miR-4458, hsa-miR-4500, hsa-miR-98-5p (sharing the same seed sequence with hsa-let-7f-5p).

References

  • Genetic polymorphisms of pri-let-7f, gene-environment and gene-gene interactions, and associations with ischemic stroke risk in Liaoning Province. Qiu L, Wang Y, Liu F, Deng S, He Z, Zheng W, Wang Y. J Int Med Res. 2023 May;51(5):3000605231173578.

  • Hsa-let-7f-1-3p targeting the circadian gene Bmal1 mediates intervertebral disc degeneration by regulating autophagy. Mei L, Zheng Y, Gao X, Ma T, Xia B, Hao Y, Wei B, Wei Y, Luo Z, Huang J. Pharmacol Res. 2022 Dec;186:106537.

  • Properties and fate of human mesenchymal stem cells upon miRNA let-7f-promoted recruitment to atherosclerotic plaques. Egea V, Megens RTA, Santovito D, Wantha S, Brandl R, Siess W, Khani S, Soehnlein O, Bartelt A, Weber C, Ries C. Cardiovasc Res. 2023 Mar 17;119(1):155-166.

  • Identification of let-7f and miR-338 as plasma-based biomarkers for sporadic amyotrophic lateral sclerosis using meta-analysis and empirical validation. Daneshafrooz N, Joghataei MT, Mehdizadeh M, Alavi A, Barati M, Panahi B, Teimourian S, Zamani B. Sci Rep. 2022 Jan 26;12(1):1373.

  • Circ_0085289 Alleviates the Progression of Periodontitis by Regulating let-7f-5p/SOCS6 Pathway. Du W, Wang L, Liao Z, Wang J. Inflammation. 2021 Aug;44(4):1607-1619.

  • let7f‑5p attenuates inflammatory injury in i Xu L, Song Q, Ouyang Z, Zhang X, Zhang C. Mol Med Rep. 2021 Feb;23(2):95.

  • Identification of Let-7f-5p as a novel biomarker of recurrence in non-muscle invasive bladder cancer. Shee K, Seigne JD, Karagas MR, Marsit CJ, Hinds JW, Schned AR, Pettus JR, Armstrong DA, Miller TW, Andrew AS. Cancer Biomark. 2020;29(1):101-110.

  • Hypoxia-induced let-7f-5p/TARBP2 feedback loop regulates osteosarcoma cell proliferation and invasion by inhibiting the Wnt signaling pathway. Chen G, Gu H, Fang T, Zhou K, Xu J, Yin X. Aging (Albany NY). 2020 Apr 17;12(8):6891-6903.

  • Reduced Let-7f in Bone Marrow-Derived Mesenchymal Stem Cells Triggers Treg/Th17 Imbalance in Patients With Systemic Lupus Erythematosus. Geng L, Tang X, Wang S, Sun Y, Wang D, Tsao BP, Feng X, Sun L. Front Immunol. 2020 Feb 18;11:233.

  • Exosomal miR-146a-5p from Treponema pallidum-stimulated macrophages reduces endothelial cells permeability and monocyte transendothelial migration by targeting JAM-C. Hu W, Xu B, Zhang J, Kou C, Liu J, Wang Q, Zhang R. Exp Cell Res. 2020 Mar 1;388(1):111823.

  • Downregulation of microRNA let-7f mediated the Adriamycin resistance in leukemia cell line. Cao YX, Wen F, Luo ZY, Long XX, Luo C, Liao P, Li JJ. J Cell Biochem. 2020 Oct;121(10):4022-4033.

  • Let-7f: A New Potential Circulating Biomarker Identified by miRNA Profiling of Cells Isolated from Human Abdominal Aortic Aneurysm. Spear R, Boytard L, Blervaque R, Chwastyniak M, Hot D, Vanhoutte J, Lamblin N, Amouyel P, Pinet F. Int J Mol Sci. 2019 Nov 5;20(21):5499.

  • Let-7f-5p ameliorates inflammation by targeting NLRP3 in bone marrow-derived mesenchymal stem cells in patients with systemic lupus erythematosus. Tan W, Gu Z, Leng J, Zou X, Chen H, Min F, Zhou W, Zhang L, Li G. Biomed Pharmacother. 2019 Oct;118:109313.

  • Let-7f-5p suppresses Th17 differentiation via targeting STAT3 in multiple sclerosis. Li ZH, Wang YF, He DD, Zhang XM, Zhou YL, Yue H, Huang S, Fu Z, Zhang LY, Mao ZQ, Li S, Zhang CY, Chen X, Fu J. Aging (Albany NY). 2019 Jul 15;11(13):4463-4477.

  • MicroRNA Let-7f-1-3p attenuates smoke-induced apoptosis in bronchial and alveolar epithelial cells in vitro by targeting FOXO1. Han Z, Zhu Y, Cui Z, Guo P, Wei A, Meng Q. Eur J Pharmacol. 2019 Nov 5;862:172531.

  • Identification of key tumorigenesis‑related genes and their microRNAs in colon cancer. Xie B, Zhao R, Bai B, Wu Y, Xu Y, Lu S, Fang Y, Wang Z, Maswikiti EP, Zhou X, Pan H, Han W. Oncol Rep. 2018 Dec;40(6):3551-3560.

  • A comprehensive evaluation for polymorphisms in Wang BG, Jiang LY, Xu Q. Biosci Rep. 2018 Jul 31;38(4):BSR20180273.

  • MAPK and NF-κB signalling pathways regulate the expression of miRNA, let-7f in human endocervical epithelial cells. Ayyar KK, Reddy KVR. J Cell Biochem. 2018 Jun;119(6):4751-4759.

  • Transcription factor CCAAT/enhancer-binding protein-β upregulates microRNA, let-7f-1 in human endocervical cells. Ayyar K, Reddy KVR. Am J Reprod Immunol. 2017 Dec;78(6).

  • [Association between expression of plasma miRNA and the risk of childhood acute lymphocytic leukemia]. Yuan DM, Wu SY, Huang SL, Jiang WC, Ke YB. Zhonghua Liu Xing Bing Xue Za Zhi. 2017 Sep 10;38(9):1252-1258.

    • There are 47 references associated with hsa-let-7f-1. Click here to see the complete list in PubMed.