Mature miRNA: mmu-miR-99b-5p

Mature miRNA

miRNA Name mmu-miR-99b-5p
Previous Name mmu-miR-99b
miRNA Sequence 5' - cacccguagaaccgaccuugcg - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000132
Similar miRNAs mmu-miR-100-5p, mmu-miR-99a-5p (sharing the same seed sequence with mmu-miR-99b-5p).

Precursor miRNA

Precursor Name mmu-mir-99b
Genomic Location chr17:17830188-17830257 (+); nearby genomic features
Clustered miRNAs mmu-mir-99b,mmu-let-7e,mmu-mir-125a (within 10kb in genome)
NCBI GENE ID 387230
miRBase ID MI0000147
Precursor Sequence 
     cc         ac   c    c - -   c
ggcac  acccguaga  cga cuug g g ggc u
|||||  |||||||||  ||| |||| | | ||| 
cugug  ugggugucu  gcu gaac c c ccg u
     cc         gu   c    a a g   c

References

  • MicroRNA-99b-3p promotes angiotensin II-induced cardiac fibrosis in mice by targeting GSK-3β. Yu YH, Zhang YH, Ding YQ, Bi XY, Yuan J, Zhou H, Wang PX, Zhang LL, Ye JT. Acta Pharmacol Sin. 2021 May;42(5):715-725.

  • MicroRNA-99b-5p downregulates protein synthesis in human primary myotubes. Zacharewicz E, Kalanon M, Murphy RM, Russell AP, Lamon S. Am J Physiol Cell Physiol. 2020 Aug 1;319(2):C432-C440.

  • The role of the miR-99b-5p/mTOR signaling pathway in neuroregeneration in mice following spinal cord injury. Cao F, Liu T, Sun S, Feng S. Mol Med Rep. 2017 Dec;16(6):9355-9360.

  • Putative binding sites for mir-125 family miRNAs in the mouse Lfng 3'UTR affect transcript expression in the segmentation clock, but mir-125a-5p is dispensable for normal somitogenesis. Wahi K, Friesen S, Coppola V, Cole SE. Dev Dyn. 2017 Oct;246(10):740-748.

  • MicroRNA-101 Regulates Multiple Developmental Programs to Constrain Excitation in Adult Neural Networks. Lippi G, Fernandes CC, Ewell LA, John D, Romoli B, Curia G, Taylor SR, Frady EP, Jensen AB, Liu JC, Chaabane MM, Belal C, Nathanson JL, Zoli M, Leutgeb JK, Biagini G, Yeo GW, Berg DK. Neuron. 2016 Dec 21;92(6):1337-1351.

  • Spherical nucleic acid targeting microRNA-99b enhances intestinal MFG-E8 gene expression and restores enterocyte migration in lipopolysaccharide-induced septic mice. Wang X, Hao L, Bu HF, Scott AW, Tian K, Liu F, De Plaen IG, Liu Y, Mirkin CA, Tan XD. Sci Rep. 2016 Aug 19;6:31687.

  • Identifying microRNAs involved in degeneration of the organ of corti during age-related hearing loss. Zhang Q, Liu H, McGee J, Walsh EJ, Soukup GA, He DZ. PLoS One. 2013 Apr 30;8(4):e62786.

  • Mycobacterium tuberculosis controls microRNA-99b (miR-99b) expression in infected murine dendritic cells to modulate host immunity. Singh Y, Kaul V, Mehra A, Chatterjee S, Tousif S, Dwivedi VP, Suar M, Van Kaer L, Bishai WR, Das G. J Biol Chem. 2013 Feb 15;288(7):5056-61.

  • MIR-99a and MIR-99b modulate TGF-β induced epithelial to mesenchymal plasticity in normal murine mammary gland cells. Turcatel G, Rubin N, El-Hashash A, Warburton D. PLoS One. 2012;7(1):e31032.

  • Isolation of fetal gonads from embryos of timed-pregnant mice for morphological and molecular studies. Li Y, Taketo T, Lau YF. Methods Mol Biol. 2012;825:3-16.

  • A high-resolution anatomical atlas of the transcriptome in the mouse embryo. Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, Magen A, Canidio E, Pagani M, Peluso I, Lin-Marq N, Koch M, Bilio M, Cantiello I, Verde R, De Masi C, Bianchi SA, Cicchini J, Perroud E, Mehmeti S, Dagand E, Schrinner S, Nürnberger A, Schmidt K, Metz K, Zwingmann C, Brieske N, Springer C, Hernandez AM, Herzog S, Grabbe F, Sieverding C, Fischer B, Schrader K, Brockmeyer M, Dettmer S, Helbig C, Alunni V, Battaini MA, Mura C, Henrichsen CN, Garcia-Lopez R, Echevarria D, Puelles E, Garcia-Calero E, Kruse S, Uhr M, Kauck C, Feng G, Milyaev N, Ong CK, Kumar L, Lam M, Semple CA, Gyenesei A, Mundlos S, Radelof U, Lehrach H, Sarmientos P, Reymond A, Davidson DR, Dollé P, Antonarakis SE, Yaspo ML, Martinez S, Baldock RA, Eichele G, Ballabio A. PLoS Biol. 2011 Jan 18;9(1):e1000582.

  • Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP. Genes Dev. 2010 May 15;24(10):992-1009.

  • MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A. Mol Hum Reprod. 2010 Jul;16(7):463-71.

  • A mammalian microRNA expression atlas based on small RNA library sequencing. Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foà R, Schliwka J, Fuchs U, Novosel A, Müller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Weir DB, Choksi R, De Vita G, Frezzetti D, Trompeter HI, Hornung V, Teng G, Hartmann G, Palkovits M, Di Lauro R, Wernet P, Macino G, Rogler CE, Nagle JW, Ju J, Papavasiliou FN, Benzing T, Lichter P, Tam W, Brownstein MJ, Bosio A, Borkhardt A, Russo JJ, Sander C, Zavolan M, Tuschl T. Cell. 2007 Jun 29;129(7):1401-14.

  • Maternal microRNAs are essential for mouse zygotic development. Tang F, Kaneda M, O'Carroll D, Hajkova P, Barton SC, Sun YA, Lee C, Tarakhovsky A, Lao K, Surani MA. Genes Dev. 2007 Mar 15;21(6):644-8.

  • Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes. Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H. Genes Dev. 2006 Jul 1;20(13):1732-43.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.

  • Embryonic stem cell-specific MicroRNAs. Houbaviy HB, Murray MF, Sharp PA. Dev Cell. 2003 Aug;5(2):351-8.

  • Identification of tissue-specific microRNAs from mouse. Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T. Curr Biol. 2002 Apr 30;12(9):735-9.