Mature miRNA: mmu-miR-485-3p

Mature miRNA

miRNA Name mmu-miR-485-3p
Previous Name mmu-miR-485-3p;mmu-miR-485*
miRNA Sequence 5' - agucauacacggcucuccucuc - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0003129

Precursor miRNA

Precursor Name mmu-mir-485
Genomic Location chr12:109734902-109734974 (+); nearby genomic features
Clustered miRNAs mmu-mir-381,mmu-mir-487b,mmu-mir-539,mmu-mir-544,mmu-mir-382,mmu-mir-134,mmu-mir-668,mmu-mir-485,mmu-mir-453,mmu-mir-154,mmu-mir-496a,mmu-mir-377,mmu-mir-541,mmu-mir-409,mmu-mir-412,mmu-mir-369,mmu-mir-410 (within 10kb in genome)
NCBI GENE ID 723875
miRBase ID MI0003492
Precursor Sequence 
   u         cu       -    a    auuc
acu ggagagagg  ggccgug auga uucg    a
||| |||||||||  ||||||| |||| ||||     u
uga cuucucucc  ucggcac uacu gagc    c
   u         uc       a    -    aaau

References

  • miR-485-3p targets SIRT1 in vascular smooth muscle cells mediating the occurrence of aortic dissection. Xie Y, Xie L, Qiu Z, He J, Jiang F, Cai M, Lin Y, Chen L. J Cell Mol Med. 2024 Jul;28(13):e18454.

  • CircPRDM5 inhibits the proliferation, migration, invasion, and glucose metabolism of gastric cancer cells by reducing GCNT4 expression in a miR-485-3p-dependent manner. Lan ZZ, Sun FH, Chen C, Niu L, Shi JD, Zhang WY. Kaohsiung J Med Sci. 2024 Mar;40(3):231-243.

  • Target-directed microRNA degradation regulates developmental microRNA expression and embryonic growth in mammals. Jones BT, Han J, Zhang H, Hammer RE, Evers BM, Rakheja D, Acharya A, Mendell JT. Genes Dev. 2023 Jul 1;37(13-14):661-674.

  • miR-485 regulates Th17 generation and pathogenesis in experimental autoimmune encephalomyelitis through targeting STAT3. Xue Y, Zhang L, Guo R, Shao X, Shi M, Yuan C, Li X, Li B. J Neuroimmunol. 2023 Jun 15;379:578100.

  • Generation of mega brown adipose tissue in adults by controlling brown adipocyte differentiation in vivo. Du Q, Wu J, Fischer C, Seki T, Jing X, Gao J, He X, Hosaka K, Tong L, Yasue A, Miyake M, Sobajima M, Oyadomari S, Sun X, Yang Y, Zhou Q, Ge M, Tao W, Yao S, Cao Y. Proc Natl Acad Sci U S A. 2022 Oct 4;119(40):e2203307119.

  • Serum extracellular vesicles containing MIAT induces atrial fibrosis, inflammation and oxidative stress to promote atrial remodeling and atrial fibrillation via blockade of miR-485-5p-mediated CXCL10 inhibition. Chen Y, Chen X, Li H, Li Y, Cheng D, Tang Y, Sang H. Clin Transl Med. 2021 Aug;11(8):e482.

  • miR-485 inhibits histone deacetylase HDAC5, HIF1α and PFKFB3 expression to alleviate epilepsy in cellular and rodent models. Pan W, Song X, Hu Q, Zhang Y. Aging (Albany NY). 2021 May 21;13(10):14416-14432.

  • LncRNA SNHG3 promotes autophagy-induced neuronal cell apoptosis by acting as a ceRNA for miR-485 to up-regulate ATG7 expression. Cao Y, Pan L, Zhang X, Guo W, Huang D. Metab Brain Dis. 2020 Dec;35(8):1361-1369.

  • miR-485-5p suppresses Schwann cell proliferation and myelination by targeting cdc42 and Rac1. Zhang Z, Li X, Li A, Wu G. Exp Cell Res. 2020 Mar 1;388(1):111803.

  • MiR-485-5p promotes the development of osteoarthritis by inhibiting cartilage differentiation in BMSCs. Chen HO, Zhang L, Tang ZY, Gong ZM. Eur Rev Med Pharmacol Sci. 2018 Jun;22(11):3294-3302.

  • Deregulation of MiR-34b/Sox2 Predicts Prostate Cancer Progression. Forno I, Ferrero S, Russo MV, Gazzano G, Giangiobbe S, Montanari E, Del Nero A, Rocco B, Albo G, Languino LR, Altieri DC, Vaira V, Bosari S. PLoS One. 2015 Jun 24;10(6):e0130060.

  • The miR-379/miR-410 cluster at the imprinted Dlk1-Dio3 domain controls neonatal metabolic adaptation. Labialle S, Marty V, Bortolin-Cavaillé ML, Hoareau-Osman M, Pradère JP, Valet P, Martin PG, Cavaillé J. EMBO J. 2014 Oct 1;33(19):2216-30.

  • Derepression of a neuronal inhibitor due to miRNA dysregulation in a schizophrenia-related microdeletion. Xu B, Hsu PK, Stark KL, Karayiorgou M, Gogos JA. Cell. 2013 Jan 17;152(1-2):262-75.

  • A high-resolution anatomical atlas of the transcriptome in the mouse embryo. Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, Magen A, Canidio E, Pagani M, Peluso I, Lin-Marq N, Koch M, Bilio M, Cantiello I, Verde R, De Masi C, Bianchi SA, Cicchini J, Perroud E, Mehmeti S, Dagand E, Schrinner S, Nürnberger A, Schmidt K, Metz K, Zwingmann C, Brieske N, Springer C, Hernandez AM, Herzog S, Grabbe F, Sieverding C, Fischer B, Schrader K, Brockmeyer M, Dettmer S, Helbig C, Alunni V, Battaini MA, Mura C, Henrichsen CN, Garcia-Lopez R, Echevarria D, Puelles E, Garcia-Calero E, Kruse S, Uhr M, Kauck C, Feng G, Milyaev N, Ong CK, Kumar L, Lam M, Semple CA, Gyenesei A, Mundlos S, Radelof U, Lehrach H, Sarmientos P, Reymond A, Davidson DR, Dollé P, Antonarakis SE, Yaspo ML, Martinez S, Baldock RA, Eichele G, Ballabio A. PLoS Biol. 2011 Jan 18;9(1):e1000582.

  • miRBase: integrating microRNA annotation and deep-sequencing data. Kozomara A, Griffiths-Jones S. Nucleic Acids Res. 2011 Jan;39(Database issue):D152-7.

  • miRNA 34a, 100, and 137 modulate differentiation of mouse embryonic stem cells. Tarantino C, Paolella G, Cozzuto L, Minopoli G, Pastore L, Parisi S, Russo T. FASEB J. 2010 Sep;24(9):3255-63.

  • Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP. Genes Dev. 2010 May 15;24(10):992-1009.

  • MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A. Mol Hum Reprod. 2010 Jul;16(7):463-71.

  • A mammalian microRNA expression atlas based on small RNA library sequencing. Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foà R, Schliwka J, Fuchs U, Novosel A, Müller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Weir DB, Choksi R, De Vita G, Frezzetti D, Trompeter HI, Hornung V, Teng G, Hartmann G, Palkovits M, Di Lauro R, Wernet P, Macino G, Rogler CE, Nagle JW, Ju J, Papavasiliou FN, Benzing T, Lichter P, Tam W, Brownstein MJ, Bosio A, Borkhardt A, Russo JJ, Sander C, Zavolan M, Tuschl T. Cell. 2007 Jun 29;129(7):1401-14.

  • The expression profile of microRNAs in mouse embryos. Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I. Nucleic Acids Res. 2006 Mar 31;34(6):1765-71.

    • There are 22 references associated with mmu-miR-485-3p. Click here to see the complete list in PubMed.