Mature miRNA: mmu-miR-329-5p

Mature miRNA

miRNA Name mmu-miR-329-5p
Previous Name mmu-miR-329*
miRNA Sequence 5' - agagguuuucugggucucuguu - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0017032

Precursor miRNA

Precursor Name mmu-mir-329
Genomic Location chr12:109713481-109713577 (+); nearby genomic features
Clustered miRNAs mmu-mir-379,mmu-mir-411,mmu-mir-299a,mmu-mir-299b,mmu-mir-380,mmu-mir-1197,mmu-mir-323,mmu-mir-758,mmu-mir-329,mmu-mir-494,mmu-mir-679,mmu-mir-1193,mmu-mir-666,mmu-mir-543,mmu-mir-495,mmu-mir-667,mmu-mir-376c,mmu-mir-654,mmu-mir-376b (within 10kb in genome)
NCBI GENE ID 723842
miRBase ID MI0000605
Precursor Sequence 
uguucgcuuc      c            uu      cuc      -   g
          ugguac ggaagagagguu  cugggu   uguuuc uuu a
          |||||| ||||||||||||  ||||||   |||||| |||  u
          acuaug cuuuuuuuccaa  gaccca   acaaag aag g
-----ccuaa      a            uc      --c      u   a

References

  • Decreased miR-329-3p upregulates Zhu L, Duan W, Yang B, Wang L. Int J Med Sci. 2023 Sep 18;20(12):1562-1569.

  • Dexmedetomidine attenuates hippocampal neuroinflammation in postoperative neurocognitive disorders by inhibiting microRNA-329-3p and activating the CREB1/IL1RA axis. Chen J, Ding Q, Jiao X, Wang B, Sun Z, Zhang Y, Zhao J. Psychopharmacology (Berl). 2022 Jul;239(7):2171-2186.

  • LncRNA-PCAT1 maintains characteristics of dermal papilla cells and promotes hair follicle regeneration by regulating miR-329/Wnt10b axis. Lin BJ, Lin GY, Zhu JY, Yin GQ, Huang D, Yan YY. Exp Cell Res. 2020 Sep 1;394(1):112031.

  • Microcystin-leucine arginine inhibits gonadotropin-releasing hormone synthesis in mice hypothalamus. Wang J, Chen Y, Chen Z, Xiang Z, Ding J, Han X. Ecotoxicol Environ Saf. 2018 Nov 15;163:391-399.

  • Deregulation of MiR-34b/Sox2 Predicts Prostate Cancer Progression. Forno I, Ferrero S, Russo MV, Gazzano G, Giangiobbe S, Montanari E, Del Nero A, Rocco B, Albo G, Languino LR, Altieri DC, Vaira V, Bosari S. PLoS One. 2015 Jun 24;10(6):e0130060.

  • The miR-379/miR-410 cluster at the imprinted Dlk1-Dio3 domain controls neonatal metabolic adaptation. Labialle S, Marty V, Bortolin-Cavaillé ML, Hoareau-Osman M, Pradère JP, Valet P, Martin PG, Cavaillé J. EMBO J. 2014 Oct 1;33(19):2216-30.

  • MicroRNA 329 suppresses angiogenesis by targeting CD146. Wang P, Luo Y, Duan H, Xing S, Zhang J, Lu D, Feng J, Yang D, Song L, Yan X. Mol Cell Biol. 2013 Sep;33(18):3689-99.

  • Identifying microRNAs involved in degeneration of the organ of corti during age-related hearing loss. Zhang Q, Liu H, McGee J, Walsh EJ, Soukup GA, He DZ. PLoS One. 2013 Apr 30;8(4):e62786.

  • A resource of vectors and ES cells for targeted deletion of microRNAs in mice. Prosser HM, Koike-Yusa H, Cooper JD, Law FC, Bradley A. Nat Biotechnol. 2011 Aug 7;29(9):840-5.

  • A high-resolution anatomical atlas of the transcriptome in the mouse embryo. Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, Magen A, Canidio E, Pagani M, Peluso I, Lin-Marq N, Koch M, Bilio M, Cantiello I, Verde R, De Masi C, Bianchi SA, Cicchini J, Perroud E, Mehmeti S, Dagand E, Schrinner S, Nürnberger A, Schmidt K, Metz K, Zwingmann C, Brieske N, Springer C, Hernandez AM, Herzog S, Grabbe F, Sieverding C, Fischer B, Schrader K, Brockmeyer M, Dettmer S, Helbig C, Alunni V, Battaini MA, Mura C, Henrichsen CN, Garcia-Lopez R, Echevarria D, Puelles E, Garcia-Calero E, Kruse S, Uhr M, Kauck C, Feng G, Milyaev N, Ong CK, Kumar L, Lam M, Semple CA, Gyenesei A, Mundlos S, Radelof U, Lehrach H, Sarmientos P, Reymond A, Davidson DR, Dollé P, Antonarakis SE, Yaspo ML, Martinez S, Baldock RA, Eichele G, Ballabio A. PLoS Biol. 2011 Jan 18;9(1):e1000582.

  • miRBase: integrating microRNA annotation and deep-sequencing data. Kozomara A, Griffiths-Jones S. Nucleic Acids Res. 2011 Jan;39(Database issue):D152-7.

  • Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68. Zhu JY, Strehle M, Frohn A, Kremmer E, Höfig KP, Meister G, Adler H. J Virol. 2010 Oct;84(19):10266-75.

  • Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP. Genes Dev. 2010 May 15;24(10):992-1009.

  • MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A. Mol Hum Reprod. 2010 Jul;16(7):463-71.

  • The miR-30 miRNA family regulates Xenopus pronephros development and targets the transcription factor Xlim1/Lhx1. Agrawal R, Tran U, Wessely O. Development. 2009 Dec;136(23):3927-36.

  • miR-210 promotes osteoblastic differentiation through inhibition of AcvR1b. Mizuno Y, Tokuzawa Y, Ninomiya Y, Yagi K, Yatsuka-Kanesaki Y, Suda T, Fukuda T, Katagiri T, Kondoh Y, Amemiya T, Tashiro H, Okazaki Y. FEBS Lett. 2009 Jul 7;583(13):2263-8.

  • Deletion of Gtl2, imprinted non-coding RNA, with its differentially methylated region induces lethal parent-origin-dependent defects in mice. Takahashi N, Okamoto A, Kobayashi R, Shirai M, Obata Y, Ogawa H, Sotomaru Y, Kono T. Hum Mol Genet. 2009 May 15;18(10):1879-88.

  • A mammalian microRNA expression atlas based on small RNA library sequencing. Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foà R, Schliwka J, Fuchs U, Novosel A, Müller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Weir DB, Choksi R, De Vita G, Frezzetti D, Trompeter HI, Hornung V, Teng G, Hartmann G, Palkovits M, Di Lauro R, Wernet P, Macino G, Rogler CE, Nagle JW, Ju J, Papavasiliou FN, Benzing T, Lichter P, Tam W, Brownstein MJ, Bosio A, Borkhardt A, Russo JJ, Sander C, Zavolan M, Tuschl T. Cell. 2007 Jun 29;129(7):1401-14.

  • Maternal microRNAs are essential for mouse zygotic development. Tang F, Kaneda M, O'Carroll D, Hajkova P, Barton SC, Sun YA, Lee C, Tarakhovsky A, Lao K, Surani MA. Genes Dev. 2007 Mar 15;21(6):644-8.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.

    • There are 22 references associated with mmu-miR-329-5p. Click here to see the complete list in PubMed.