Mature miRNA: mmu-miR-322-5p

Mature miRNA

miRNA Name mmu-miR-322-5p
Previous Name mmu-miR-322-5p;mmu-miR-424;mmu-miR-322
miRNA Sequence 5' - cagcagcaauucauguuuugga - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000548
Similar miRNAs mmu-miR-15a-5p, mmu-miR-15b-5p, mmu-miR-16-5p, mmu-miR-1907, mmu-miR-195a-5p, mmu-miR-195b, mmu-miR-497a-5p, mmu-miR-6342, mmu-miR-6353, mmu-miR-6419 (sharing the same seed sequence with mmu-miR-322-5p).

Precursor miRNA

Precursor Name mmu-mir-322
Genomic Location chrX:53054255-53054349 (-); nearby genomic features
Clustered miRNAs mmu-mir-450b,mmu-mir-450a-1,mmu-mir-450a-2,mmu-mir-542,mmu-mir-351,mmu-mir-503,mmu-mir-322 (within 10kb in genome)
NCBI GENE ID 723907
miRBase ID MI0000590
Precursor Sequence 
ccucguuga   -       c  ca     aa             g auu
         cuc cgaaggg ug  gcagc  uucauguuuugga u   g
         ||| ||||||| ||  |||||  ||||||||||||| |   
         ggg gcuuccc ac  cgucg  aaguacaaaacuu g   c
------aag   u       c  aa     cg             g aac

References

  • Endocrine-exocrine miR-503-322 drives aging-associated pancreatitis via targeting MKNK1 in acinar cells. Liu K, Lv T, He L, Tang W, Zhang Y, Xiao X, Li Y, Chang X, Wang S, Pandol SJ, Li L, Han X, Zhu Y. Nat Commun. 2025 Mar 17;16(1):2613.

  • MiR-322-5p is involved in regulating chondrocyte proliferation and differentiation in offspring's growth plate of maternal gestational diabetes. Qian F, Chen X, Wang S, Zhong Y, Liu M, Wang G, Yang X, Cheng X. Sci Rep. 2024 Aug 29;14(1):20136.

  • Target-directed microRNA degradation regulates developmental microRNA expression and embryonic growth in mammals. Jones BT, Han J, Zhang H, Hammer RE, Evers BM, Rakheja D, Acharya A, Mendell JT. Genes Dev. 2023 Jul 1;37(13-14):661-674.

  • MicroRNA-322 overexpression reduces neural tube defects in diabetic pregnancies. Wang G, Song S, Shen WB, Reece EA, Yang P. Am J Obstet Gynecol. 2024 Feb;230(2):254.e1-254.e13.

  • 6-Gingerol via overexpression of miR-322-5p impede lipopolysaccharide-caused inflammatory response in RAW264.7 cells. Umar T, Yin B, He L, Feng W, Yuan Y, Umer S, Feng H, Huang Z, Umar Z, Liu W, Ganzhen D. Naunyn Schmiedebergs Arch Pharmacol. 2023 Dec;396(12):3797-3807.

  • MircoRNA-322-5p promotes lipopolysaccharide-induced acute kidney injury mouse models and mouse primary proximal renal tubular epithelial cell injury by regulating T-box transcription factor 21/mitogen-activated protein kinase/extracellular signal-related kinase axis. Ji X, Liu X, Li X, Du X, Fan L. Nefrologia (Engl Ed). 2023 Dec;43 Suppl 2:8-20.

  • miR-424(322)-5p targets Yue Y, Feng X, Jia Y, Luo S, Jiang M, Luo J, Hua Y, Zhang J, Lin Y, Li J, Xiong Y. Acta Biochim Biophys Sin (Shanghai). 2023 Mar 25;55(3):472-483.

  • miR-322 promotes the differentiation of embryonic stem cells into cardiomyocytes. Liu K, Peng X, Luo L. Funct Integr Genomics. 2023 Mar 18;23(2):87.

  • A long non-coding RNA LncSync regulates mouse cardiomyocyte homeostasis and cardiac hypertrophy through coordination of miRNA actions. Huang R, Liu J, Chen X, Zhi Y, Ding S, Ming J, Li Y, Wang Y, Na J. Protein Cell. 2023 Mar 16;14(2):153-157.

  • Upregulated miR-322-5p regulates cell cycle and promotes cell proliferation and apoptosis by directly targeting Wee1 in mice liver injury. Tong H, Wang L, Shi J, Jin H, Zhang K, Bao Y, Wu Y, Cheng Y, Liu P, Wang C. Cell Cycle. 2022 Dec;21(24):2635-2650.

  • TNF Signaling Acts Downstream of MiR-322/-503 in Regulating DM1 Myogenesis. Li M, Xu F, Liu Z, Wang C, Zhao Y, Zhu G, Shen X. Front Endocrinol (Lausanne). 2022 Apr 7;13:843202.

  • H19X-encoded miR-322(424)/miR-503 regulates muscle mass by targeting translation initiation factors. Liang R, Shen X, Wang F, Wang X, DesJarlais A, Syed A, Saba R, Tan Z, Yu F, Ji X, Shrestha S, Ren Y, Yang J, Park Y, Schwartz RJ, Soibam B, McConnell BK, Stewart MD, Kumar A, Liu Y. J Cachexia Sarcopenia Muscle. 2021 Dec;12(6):2174-2186.

  • miR-322/-503 rescues myoblast defects in myotonic dystrophy type 1 cell model by targeting CUG repeats. Shen X, Xu F, Li M, Wu S, Zhang J, Wang A, Xu L, Liu Y, Zhu G. Cell Death Dis. 2020 Oct 22;11(10):891.

  • Myeloid-derived suppressor cells shift Th17/Treg ratio and promote systemic lupus erythematosus progression through arginase-1/miR-322-5p/TGF-β pathway. Pang B, Zhen Y, Hu C, Ma Z, Lin S, Yi H. Clin Sci (Lond). 2020 Aug 28;134(16):2209-2222.

  • MicroRNA 322 Aggravates Dexamethasone-Induced Muscle Atrophy by Targeting Geng H, Song Q, Cheng Y, Li H, Yang R, Liu S, Hao L. Int J Mol Sci. 2020 Feb 7;21(3):1111.

  • Roles of the hypoximir microRNA-424/322 in acute hypoxia and hypoxia-induced pulmonary vascular leakage. Tsai SH, Huang PH, Tsai HY, Hsu YJ, Chen YW, Wang JC, Chen YH, Lin SJ. FASEB J. 2019 Nov;33(11):12565-12575.

  • MiR322 mediates cardioprotection against ischemia/reperfusion injury via FBXW7/notch pathway. Chen Z, Su X, Shen Y, Jin Y, Luo T, Kim IM, Weintraub NL, Tang Y. J Mol Cell Cardiol. 2019 Aug;133:67-74.

  • miR-322 stabilizes MEK1 expression to inhibit RAF/MEK/ERK pathway activation in cartilage. Bluhm B, Ehlen HWA, Holzer T, Georgieva VS, Heilig J, Pitzler L, Etich J, Bortecen T, Frie C, Probst K, Niehoff A, Belluoccio D, Van den Bergen J, Brachvogel B. Development. 2017 Oct 1;144(19):3562-3577.

  • miR-424(322)/503 is a breast cancer tumor suppressor whose loss promotes resistance to chemotherapy. Rodriguez-Barrueco R, Nekritz EA, Bertucci F, Yu J, Sanchez-Garcia F, Zeleke TZ, Gorbatenko A, Birnbaum D, Ezhkova E, Cordon-Cardo C, Finetti P, Llobet-Navas D, Silva JM. Genes Dev. 2017 Mar 15;31(6):553-566.

  • MicroRNA-322 inhibits inflammatory cytokine expression and promotes cell proliferation in LPS-stimulated murine macrophages by targeting NF-κB1 (p50). Zhang K, Song F, Lu X, Chen W, Huang C, Li L, Liang D, Cao S, Dai H. Biosci Rep. 2017 Jan 17;37(1):BSR20160239.

    • There are 47 references associated with mmu-miR-322-5p. Click here to see the complete list in PubMed.