Mature miRNA: mmu-miR-15a-5p

Mature miRNA

miRNA Name mmu-miR-15a-5p
Previous Name mmu-miR-15a
miRNA Sequence 5' - uagcagcacauaaugguuugug - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000526
Similar miRNAs mmu-miR-15b-5p, mmu-miR-16-5p, mmu-miR-1907, mmu-miR-195a-5p, mmu-miR-195b, mmu-miR-322-5p, mmu-miR-497a-5p, mmu-miR-6342, mmu-miR-6353, mmu-miR-6419 (sharing the same seed sequence with mmu-miR-15a-5p).

Precursor miRNA

Precursor Name mmu-mir-15a
Genomic Location chr14:61632027-61632110 (-); nearby genomic features
Clustered miRNAs mmu-mir-16-1,mmu-mir-15a (within 10kb in genome)
NCBI GENE ID 387174
miRBase ID MI0000564
Precursor Sequence 
c     gaguaaa ua        ua          ga gu
 ccuug       g  gcagcaca  augguuugug  u  u
 |||||       |  ||||||||  ||||||||||  |   g
 ggaac       c  cgucgugu  uaccggacgu  a  a
a     -auaaaa uc        ca          gg aa

References

  • Loss of microRNA-15a/16-1 function promotes neuropathological and functional recovery in experimental traumatic brain injury. Zhou C, Li S, Qiu N, Sun P, Hamblin MH, Dixon CE, Chen J, Yin KJ. JCI Insight. 2024 Jun 24;9(12):e178650.

  • microRNA-15a-5p suppresses hypoxia-induced tumor growth and chemoresistance in bladder cancer by binding to eIF5A2. Yang J, Xiang H, Cheng M, Jiang X, Chen Y, Zheng L, Yan S, Zhang S, Zhang C, Chen W, Chen D. Neoplasma. 2024 Feb;71(1):60-69.

  • miR-195b is required for proper cellular homeostasis in the elderly. Muñoz-Gallardo MDM, Garcia-Padilla C, Vicente-Garcia C, Carvajal J, Arenega A, Franco D. Sci Rep. 2024 Jan 8;14(1):810.

  • An essential role for miR-15/16 in Treg suppression and restriction of proliferation. Johansson K, Gagnon JD, Zhou SK, Fassett MS, Schroeder AW, Kageyama R, Bautista RA, Pham H, Woodruff PG, Ansel KM. Cell Rep. 2023 Oct 31;42(10):113298.

  • miR-15a-5p up-regulates TLR4 and induces the formation of hypertrophic scars and keloids. Pang J, Zhu L, Lv Y, Xu L, Li N, Guo P, Feng Q. Cell Mol Biol (Noisy-le-grand). 2023 Jul 31;69(7):158-163.

  • Role of miR-15a-5p and miR-199a-3p in the inflammatory pathway regulated by NF-κB in experimental and human atherosclerosis. González-López P, Álvarez-Villarreal M, Ruiz-Simón R, López-Pastor AR, de Ceniga MV, Esparza L, Martín-Ventura JL, Escribano Ó, Gómez-Hernández A. Clin Transl Med. 2023 Aug;13(8):e1363.

  • MicroRNA-15a/β1,4-GalT-I axis contributes to cartilage degeneration via NF-κB signaling in osteoarthritis. Wang H, Wang W, Wang J, Zhang L, Luo Y, Tang X. Clinics (Sao Paulo). 2023 Jul 19;78:100254.

  • Knockdown of Chk1 inhibits proliferation and promotes apoptosis in mouse granulosa cells and its regulation mechanism by miR-15a and miR-16. Liu XM, Chen F, Zhang F, Xi HT, Zhao JZ. In Vitro Cell Dev Biol Anim. 2022 Aug;58(7):579-586.

  • Bone marrow mesenchymal stem cell-derived exosomes carrying long noncoding RNA ZFAS1 alleviate oxidative stress and inflammation in ischemic stroke by inhibiting microRNA-15a-5p. Yang H, Chen J. Metab Brain Dis. 2022 Oct;37(7):2545-2557.

  • In Vivo Murgia N, Ma Y, Najam SS, Liu Y, Przybys J, Guo C, Konopka W, Vinnikov IA. Front Endocrinol (Lausanne). 2022 Jul 7;13:867929.

  • MicroRNA-15a inhibits hepatic stellate cell activation and proliferation via targeting SRY-box transcription factor 9. Fu M, Yin W, Zhang W, Zhu Y, Ni H, Gong L. Bioengineered. 2022 May;13(5):13011-13020.

  • Genetic Deficiency of MicroRNA-15a/16-1 Confers Resistance to Neuropathological Damage and Cognitive Dysfunction in Experimental Vascular Cognitive Impairment and Dementia. Zhou C, Sun P, Xu Y, Chen Y, Huang Y, Hamblin MH, Foley L, Hitchens TK, Li S, Yin KJ. Adv Sci (Weinh). 2022 Jun;9(17):e2104986.

  • T-cell activation decreases miRNA-15a/16 levels to promote MEK1-ERK1/2-Elk1 signaling and proliferative capacity. Urena F, Ma C, Hoffmann FW, Nunes LGA, Urschitz J, Moisyadi S, Khadka VS, Deng Y, Hoffmann PR. J Biol Chem. 2022 Mar;298(3):101634.

  • MiR-15p-5p Mediates the Coordination of ICAM-1 and FAK to Promote Endothelial Cell Proliferation and Migration. Gu W, Zhang L, Zhang X, Wang B, Shi X, Hu K, Ye Y, Liu G. Inflammation. 2022 Jun;45(3):1402-1417.

  • MicroRNA-15a/16-1 Prevents Hepatocellular Carcinoma by Disrupting the Communication Between Kupffer Cells and Regulatory T Cells. Liu N, Chang CW, Steer CJ, Wang XW, Song G. Gastroenterology. 2022 Feb;162(2):575-589.

  • The Egr-1/miR-15a-5p/GPX4 axis regulates ferroptosis in acute myocardial infarction. Fan K, Huang W, Qi H, Song C, He C, Liu Y, Zhang Q, Wang L, Sun H. Eur J Pharmacol. 2021 Oct 15;909:174403.

  • Dysregulation of miR-15a-5p, miR-497a-5p and miR-511-5p Is Associated with Modulation of BDNF and FKBP5 in Brain Areas of PTSD-Related Susceptible and Resilient Mice. Maurel OM, Torrisi SA, Barbagallo C, Purrello M, Salomone S, Drago F, Ragusa M, Leggio GM. Int J Mol Sci. 2021 May 13;22(10):5157.

  • Genetic deletion of endothelial microRNA-15a/16-1 promotes cerebral angiogenesis and neurological recovery in ischemic stroke through Src signaling pathway. Sun P, Ma F, Xu Y, Zhou C, Stetler RA, Yin KJ. J Cereb Blood Flow Metab. 2021 Oct;41(10):2725-2742.

  • Deficiency of miR-15a/16 upregulates NKG2D in CD8 Jia X, Wei Y, Miao X, Zhu T, Hu X, Lin Z, Xiao W, Zhang Y, Wang Z, Gong W. Biochem Biophys Res Commun. 2021 May 21;554:114-122.

  • miR-15a/16-1 deletion in activated B cells promotes plasma cell and mature B-cell neoplasms. Sewastianik T, Straubhaar JR, Zhao JJ, Samur MK, Adler K, Tanton HE, Shanmugam V, Nadeem O, Dennis PS, Pillai V, Wang J, Jiang M, Lin J, Huang Y, Brooks D, Bouxsein M, Dorfman DM, Pinkus GS, Robbiani DF, Ghobrial IM, Budnik B, Jarolim P, Munshi NC, Anderson KC, Carrasco RD. Blood. 2021 Apr 8;137(14):1905-1919.

    • There are 92 references associated with mmu-miR-15a-5p. Click here to see the complete list in PubMed.