Mature miRNA: mmu-miR-19b-3p

Mature miRNA

miRNA Name mmu-miR-19b-3p
Previous Name mmu-miR-19b
miRNA Sequence 5' - ugugcaaauccaugcaaaacuga - 3' (length = 23)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000513
Similar miRNAs mmu-miR-19a-3p (sharing the same seed sequence with mmu-miR-19b-3p).

Precursor miRNA

Precursor Name mmu-mir-19b-1
Genomic Location chr14:115044305-115044391 (+); nearby genomic features
Clustered miRNAs mmu-mir-17,mmu-mir-18a,mmu-mir-19a,mmu-mir-20a,mmu-mir-19b-1,mmu-mir-92a-1 (within 10kb in genome)
NCBI GENE ID 751527
miRBase ID MI0000718
Precursor Sequence 
    ggu                 -  -      uc    uguau
cacu   cuaugguuaguuuugca gg uuugca  cagc     a
||||   ||||||||||||||||| || ||||||  ||||      a
gugg   ggugucagucaaaacgu cc aaacgu  gucg     u
    --u                 a  u      --    ucuua
Precursor Name mmu-mir-19b-2
Genomic Location chrX:52741983-52742066 (-); nearby genomic features
Clustered miRNAs mmu-mir-363,mmu-mir-92a-2,mmu-mir-19b-2,mmu-mir-20b,mmu-mir-18b,mmu-mir-106a (within 10kb in genome)
NCBI GENE ID 387195
miRBase ID MI0000546
Precursor Sequence 
a                  --        guu    -      g
 cuuacgauuaguuuugca  gauuugca   cagc guauau u
 ||||||||||||||||||  ||||||||   |||| |||||| 
 ggguguuagucaaaacgu  cuaaacgu   gucg uauaua g
a                  ac        ---    g      a

References

  • MicroRNA-19b exacerbates systemic sclerosis through promoting Th9 cells. Lim YJ, Park SA, Wang D, Jin W, Ku WL, Zhang D, Xu J, Patiño LC, Liu N, Chen W, Kazmi R, Zhao K, Zhang YE, Sun L, Chen W. Cell Rep. 2024 Aug 27;43(8):114565.

  • Sex-biased gene and microRNA expression in the developing mouse brain is associated with neurodevelopmental functions and neurological phenotypes. Szakats S, McAtamney A, Cross H, Wilson MJ. Biol Sex Differ. 2023 Sep 7;14(1):57.

  • MicroRNA-19b-3p dysfunction of mesenchymal stem cell-derived exosomes from patients with abdominal aortic aneurysm impairs therapeutic efficacy. Zhang Y, Huang X, Sun T, Shi L, Liu B, Hong Y, Fu QL, Zhang Y, Li X. J Nanobiotechnology. 2023 Apr 26;21(1):135.

  • Antagonizing microRNA-19a/b augments PTH anabolic action and restores bone mass in osteoporosis in mice. Taipaleenmäki H, Saito H, Schröder S, Maeda M, Mettler R, Ring M, Rollmann E, Gasser A, Haasper C, Gehrke T, Weiss A, Grimm SK, Hesse E. EMBO Mol Med. 2022 Nov 8;14(11):e13617.

  • MiR-19b-3p regulated by BC002059/ABHD10 axis promotes cell apoptosis in myocardial infarction. Liao B, Dong S, Xu Z, Gao F, Zhang S, Liang R. Biol Direct. 2022 Aug 18;17(1):20.

  • SOCS6 Promotes Mitochondrial Fission and Cardiomyocyte Apoptosis and Is Negatively Regulated by Quaking-Mediated miR-19b. Zhang P, Guan P, Ye X, Lu Y, Hang Y, Su Y, Hu W. Oxid Med Cell Longev. 2022 Jan 27;2022:1121323.

  • microRNA-19b-3p-containing extracellular vesicles derived from macrophages promote the development of atherosclerosis by targeting JAZF1. Wang Q, Dong Y, Wang H. J Cell Mol Med. 2022 Jan;26(1):48-59.

  • Endurance exercise training-responsive miR-19b-3p improves skeletal muscle glucose metabolism. Massart J, Sjögren RJO, Egan B, Garde C, Lindgren M, Gu W, Ferreira DMS, Katayama M, Ruas JL, Barrès R, O'Gorman DJ, Zierath JR, Krook A. Nat Commun. 2021 Oct 12;12(1):5948.

  • Knockdown of lncRNA XIST inhibited apoptosis and inflammation in renal fibrosis via microRNA-19b-mediated downregulation of SOX6. Xia WP, Chen X, Ru F, He Y, Liu PH, Gan Y, Zhang B, Li Y, Dai GY, Jiang ZX, Chen Z. Mol Immunol. 2021 Nov;139:87-96.

  • Methylation of miR-19b-3p promoter exacerbates inflammatory responses in sepsis-induced ALI via targeting KLF7. Jiang L, Wang M, Sun R, Lin Z, Liu R, Cai H, Tang Z, Zhang R. Cell Biol Int. 2021 Aug;45(8):1666-1675.

  • Fibrinogen inhibits microRNA-19b, a novel mechanism for repair of haemorrhagic shock-induced endothelial cell dysfunction. Chipman AM, Wu F, Kozar RA. Blood Transfus. 2021 Sep;19(5):420-427.

  • Loss of Phua YL, Chen KH, Hemker SL, Marrone AK, Bodnar AJ, Liu X, Clugston A, Kostka D, Butterworth MB, Ho J. Am J Physiol Renal Physiol. 2019 May 1;316(5):F993-F1005.

  • MicroRNA-19b-1 reverses ischaemia-induced heart failure by inhibiting cardiomyocyte apoptosis and targeting Bcl2 l11/BIM. Yang W, Han Y, Yang C, Chen Y, Zhao W, Su X, Yang K, Jin W. Heart Vessels. 2019 Jul;34(7):1221-1229.

  • Lung fibroblasts express a miR-19a-19b-20a sub-cluster to suppress TGF-β-associated fibroblast activation in murine pulmonary fibrosis. Souma K, Shichino S, Hashimoto S, Ueha S, Tsukui T, Nakajima T, Suzuki HI, Shand FHW, Inagaki Y, Nagase T, Matsushima K. Sci Rep. 2018 Nov 9;8(1):16642.

  • MicroRNA-19a/b-3p protect the heart from hypertension-induced pathological cardiac hypertrophy through PDE5A. Liu K, Hao Q, Wei J, Li GH, Wu Y, Zhao YF. J Hypertens. 2018 Sep;36(9):1847-1857.

  • Sphingosine kinase 1 promotes liver fibrosis by preventing miR-19b-3p-mediated inhibition of CCR2. Lan T, Li C, Yang G, Sun Y, Zhuang L, Ou Y, Li H, Wang G, Kisseleva T, Brenner D, Guo J. Hepatology. 2018 Sep;68(3):1070-1086.

  • Endothelial microparticles-mediated transfer of microRNA-19b promotes atherosclerosis via activating perivascular adipose tissue inflammation in apoE Li C, Li S, Zhang F, Wu M, Liang H, Song J, Lee C, Chen H. Biochem Biophys Res Commun. 2018 Jan 8;495(2):1922-1929.

  • Sema3F (Semaphorin 3F) Selectively Drives an Extraembryonic Proangiogenic Program. Regano D, Visintin A, Clapero F, Bussolino F, Valdembri D, Maione F, Serini G, Giraudo E. Arterioscler Thromb Vasc Biol. 2017 Sep;37(9):1710-1721.

  • Inhibition of the miR-17-92 Cluster Separates Stages of Palatogenesis. Ries RJ, Yu W, Holton N, Cao H, Amendt BA. J Dent Res. 2017 Oct;96(11):1257-1264.

  • Effects of microRNA-19b on airway remodeling, airway inflammation and degree of oxidative stress by targeting TSLP through the Stat3 signaling pathway in a mouse model of asthma. Ye L, Mou Y, Wang J, Jin ML. Oncotarget. 2017 Jul 18;8(29):47533-47546.

    • There are 69 references associated with mmu-miR-19b-3p. Click here to see the complete list in PubMed.