Mature miRNA: mmu-miR-141-3p

Mature miRNA

miRNA Name mmu-miR-141-3p
Previous Name mmu-miR-141
miRNA Sequence 5' - uaacacugucugguaaagaugg - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0000153
Similar miRNAs mmu-miR-200a-3p (sharing the same seed sequence with mmu-miR-141-3p).

Precursor miRNA

Precursor Name mmu-mir-141
Genomic Location chr6:124717914-124717985 (-); nearby genomic features
Clustered miRNAs mmu-mir-141,mmu-mir-200c (within 10kb in genome)
NCBI GENE ID 387159
miRBase ID MI0000166
Precursor Sequence 
   u       --    u          au    gaa
ggg ccaucuu  ccag gcaguguugg  gguu   g
||| |||||||  |||| ||||||||||  ||||    u
ccc gguagaa  gguc ugucacaauc  ucga   a
   -       au    -          -c    agu

References

  • miR-141-3p alleviates ulcerative colitis by targeting SUGT1 to inhibit colonic epithelial cell pyroptosis. Yan R, Liang X, Hu J. Autoimmunity. 2023 Dec;56(1):2220988.

  • microRNA-141-3p mediates epithelial cell proliferation, apoptosis, and epithelial-mesenchymal transition and alleviates pulmonary fibrosis in mice via Spred2. Zhu L, Chen M, Wang W, Zhu J, Wu H. Histol Histopathol. 2023 Nov;38(11):1269-1282.

  • Inhibition of miR-141-3p attenuates apoptosis of neural stem cells via targeting PBX1 to regulate PROK2 transcription in MCAO mice. Liu T, Feng J, Sun Z, He M, Sun L, Dong S, Guo Z, Zhang G. Cell Cycle. 2023 Feb;22(4):403-418.

  • miR-141 exacerbates lung ischemia-reperfusion injury by targeting EGFR/β-catenin axis-mediated autophagy. Yang M, Ling X, Xiao J. Aging (Albany NY). 2022 Aug 16;14(16):6507-6519.

  • MicroRNA-141-3p attenuates oxidative stress-induced hepatic ischemia reperfusion injury via Keap1/Nrf2 pathway. Li T, Chen Q, Dai J, Huang Z, Luo Y, Mou T, Pu J, Yang H, Wei X, Wu Z. Mol Biol Rep. 2022 Aug;49(8):7575-7585.

  • miR-141-3p protects against blood-brain barrier disruption and brain injury after intracerebral hemorrhage by targeting ZEB2. Yu M, Tian T, Zhang J, Hu T. J Clin Neurosci. 2022 May;99:253-260.

  • MiR-141-3p regulates myogenic differentiation in C2C12 myoblasts via CFL2-YAP-mediated mechanotransduction. Nguyen MT, Lee W. BMB Rep. 2022 Feb;55(2):104-109.

  • The miR-200 family is required for ectodermal organ development through the regulation of the epithelial stem cell niche. Sweat M, Sweat Y, Yu W, Su D, Leonard RJ, Eliason SL, Amendt BA. Stem Cells. 2021 Jun;39(6):761-775.

  • miR-141-3p inhibits vascular smooth muscle cell proliferation and migration via regulating Keap1/Nrf2/HO-1 pathway. Zhang C, Kong X, Ma D. IUBMB Life. 2020 Oct;72(10):2167-2179.

  • Inactivation of Carpinelli MR, de Vries ME, Auden A, Butt T, Deng Z, Partridge DD, Miles LB, Georgy SR, Haigh JJ, Darido C, Brabletz S, Brabletz T, Stemmler MP, Dworkin S, Jane SM. Dis Model Mech. 2020 Mar 25;13(3):dmm042218.

  • MicroRNA-141-3p Negatively Modulates SDF-1 Expression in Age-Dependent Pathophysiology of Human and Murine Bone Marrow Stromal Cells. Periyasamy-Thandavan S, Burke J, Mendhe B, Kondrikova G, Kolhe R, Hunter M, Isales CM, Hamrick MW, Hill WD, Fulzele S. J Gerontol A Biol Sci Med Sci. 2019 Aug 16;74(9):1368-1374.

  • MicroRNA-141 ameliorates alcoholic hepatitis‑induced intestinal injury and intestinal endotoxemia partially via a TLR4-dependent mechanism. Qian WH, Liu YY, Li X, Pan Y. Int J Mol Med. 2019 Aug;44(2):569-581.

  • miR-200c/141 Regulates Breast Cancer Stem Cell Heterogeneity via Targeting HIPK1/β-Catenin Axis. Liu B, Du R, Zhou L, Xu J, Chen S, Chen J, Yang X, Liu DX, Shao ZM, Zhang L, Yu Z, Xie N, Guan JL, Liu S. Theranostics. 2018 Nov 10;8(21):5801-5813.

  • Suppression of microRNA-141 suppressed p53 to protect against neural apoptosis in epilepsy by SIRT1 expression. Liu D, Li S, Gong L, Yang Y, Han Y, Xie M, Zhang C. J Cell Biochem. 2019 Jun;120(6):9409-9420.

  • MicroRNA-141-3p inhibits retinal neovascularization and retinal ganglion cell apoptosis in glaucoma mice through the inactivation of Docking protein 5-dependent mitogen-activated protein kinase signaling pathway. Zhang LQ, Cui H, Yu YB, Shi HQ, Zhou Y, Liu MJ. J Cell Physiol. 2019 Jun;234(6):8873-8887.

  • Elevated microRNA-141-3p in placenta of non-diabetic macrosomia regulate trophoblast proliferation. Guo D, Jiang H, Chen Y, Yang J, Fu Z, Li J, Han X, Wu X, Xia Y, Wang X, Chen L, Tang Q, Wu W. EBioMedicine. 2018 Dec;38:154-161.

  • Knockdown of lncRNA H19 inhibits abnormal differentiation of small intestinal epithelial cells in diabetic mice. Shan TD, Lv SY, Tian ZB, Liu XS, Liu FG, Sun XG. J Cell Physiol. 2018 Jan;234(1):837-848.

  • MicroRNA-141-3p/200a-3p target and may be involved in post-transcriptional repression of RNA decapping enzyme Dcp2 during renal development. Zhang MN, Tang QY, Li RM, Song MG. Biosci Biotechnol Biochem. 2018 Oct;82(10):1724-1732.

  • The microRNA-200 family coordinately regulates cell adhesion and proliferation in hair morphogenesis. Hoefert JE, Bjerke GA, Wang D, Yi R. J Cell Biol. 2018 Jun 4;217(6):2185-2204.

  • Faecal microRNAs: indicators of imbalance at the host-microbe interface? Moloney GM, Viola MF, Hoban AE, Dinan TG, Cryan JF. Benef Microbes. 2018 Feb 27;9(2):175-183.

    • There are 57 references associated with mmu-miR-141-3p. Click here to see the complete list in PubMed.