Mature miRNA: hsa-miR-657

Mature miRNA

miRNA Name hsa-miR-657
miRNA Sequence 5' - ggcagguucucacccucucuagg - 3' (length = 23)
Predicted Targets miRDB
Validated Targets TarBase
Targeted Pathways miRDB
miRBase ID MIMAT0003335

Precursor miRNA

Precursor Name hsa-mir-657
Genomic Location chr17:81125276-81125373 (-); nearby genomic features
Clustered miRNAs hsa-mir-657,hsa-mir-3065,hsa-mir-338,hsa-mir-1250 (within 10kb in genome)
NCBI GENE ID 724027
miRBase ID MI0003681
Precursor Sequence 
guguaguagagcua        --   u        agcguggaccggucc       uu  g
              ggaggaga  ggg ccuggaga               ggguggg  cc g
              ||||||||  ||| ||||||||               |||||||  || 
              ucuccucu  ccc ggaucucu               cccacuc  gg c
-------------g        ua   c        ---------------       uu  a

References

  • MicroRNA hsa-miR-657 promotes retinoblastoma malignancy by inhibiting peroxisome proliferator-activated receptor alpha expression. He X, Feng Y. Anticancer Drugs. 2022 Jun 1;33(5):478-488.

  • Regulation of ETAA1-mediated ATR activation couples DNA replication fidelity and genome stability. Achuthankutty D, Thakur RS, Haahr P, Hoffmann S, Drainas AP, Bizard AH, Weischenfeldt J, Hickson ID, Mailand N. J Cell Biol. 2019 Dec 2;218(12):3943-3953.

  • Dysregulation of microRNA-657 influences inflammatory response via targeting interleukin-37 in gestational diabetes mellitus. Wang P, Wang H, Li C, Zhang X, Xiu X, Teng P, Wang Z. J Cell Physiol. 2019 May;234(5):7141-7148.

  • Identification of predictive biomarkers for early diagnosis of larynx carcinoma based on microRNA expression data. Wang Y, Chen M, Tao Z, Hua Q, Chen S, Xiao B. Cancer Genet. 2013 Sep-Oct;206(9-10):340-6.

  • MicroRNA-657 promotes tumorigenesis in hepatocellular carcinoma by targeting transducin-like enhancer protein 1 through nuclear factor kappa B pathways. Zhang L, Yang L, Liu X, Chen W, Chang L, Chen L, Loera S, Chu P, Huang WC, Liu YR, Yen Y. Hepatology. 2013 May;57(5):1919-30.

  • Multiple microRNAs modulate p21Cip1/Waf1 expression by directly targeting its 3' untranslated region. Wu S, Huang S, Ding J, Zhao Y, Liang L, Liu T, Zhan R, He X. Oncogene. 2010 Apr 15;29(15):2302-8.

  • Allele-specific targeting of hsa-miR-657 to human IGF2R creates a potential mechanism underlying the association of ACAA-insertion/deletion polymorphism with type 2 diabetes. Lv K, Guo Y, Zhang Y, Wang K, Jia Y, Sun S. Biochem Biophys Res Commun. 2008 Sep 12;374(1):101-5.

  • The colorectal microRNAome. Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE. Proc Natl Acad Sci U S A. 2006 Mar 7;103(10):3687-92.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.