Mature miRNA: hsa-miR-519a-3p

Mature miRNA

miRNA Name hsa-miR-519a-3p
Previous Name hsa-miR-519a
miRNA Sequence 5' - aaagugcauccuuuuagagugu - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0002869
Similar miRNAs hsa-miR-519b-3p, hsa-miR-519c-3p (sharing the same seed sequence with hsa-miR-519a-3p).

Precursor miRNA

Precursor Name hsa-mir-519a-1
Genomic Location chr19:53752397-53752481 (+); nearby genomic features
Clustered miRNAs hsa-mir-520h,hsa-mir-521-1,hsa-mir-522,hsa-mir-519a-1,hsa-mir-527,hsa-mir-516a-1,hsa-mir-1283-2,hsa-mir-516a-2,hsa-mir-519a-2 (within 10kb in genome)
NCBI GENE ID 574496
miRBase ID MI0003178
Precursor Sequence 
       u                 a         guug  u
cucaggc gugacacucuagaggga gcgcuuucu    uc g
||||||| ||||||||||||||||| |||||||||    ||  a
gaguuug cauugugagauuuuccu cgugaaagg    ag a
       u                 a         --aa  a
Precursor Name hsa-mir-519a-2
Genomic Location chr19:53762344-53762430 (+); nearby genomic features
Clustered miRNAs hsa-mir-519a-1,hsa-mir-527,hsa-mir-516a-1,hsa-mir-1283-2,hsa-mir-516a-2,hsa-mir-519a-2 (within 10kb in genome)
NCBI GENE ID 574500
miRBase ID MI0003182
Precursor Sequence 
        u   u c     c     a         guug  u
ucucaggc gug c cucua aggga gcgcuuucu    uc g
|||||||| ||| | ||||| ||||| |||||||||    ||  a
agaguuug cau g gagau uuccu cgugaaagg    ag a
        u   u u     u     a         --aa  a

References

  • Restored microRNA-519a enhances the radiosensitivity of non-small cell lung cancer via suppressing EphA2. Gong S, Li Y, Lv L, Men W. Gene Ther. 2022 Nov;29(10-11):588-600.

  • MiR-519d-3p in Trophoblastic Cells: Effects, Targets and Transfer to Allogeneic Immune Cells via Extracellular Vesicles. Chaiwangyen W, Murrieta-Coxca JM, Favaro RR, Photini SM, Gutiérrez-Samudio RN, Schleussner E, Markert UR, Morales-Prieto DM. Int J Mol Sci. 2020 May 14;21(10):3458.

  • Upregulation of miR-519 enhances radiosensitivity of esophageal squamous cell carcinoma trough targeting PI3K/AKT/mTOR signaling pathway. Zhang Y, Chen W, Wang H, Pan T, Zhang Y, Li C. Cancer Chemother Pharmacol. 2019 Dec;84(6):1209-1218.

  • Change in OncomicroRNA Expression in the Placenta during Preeclampsia. Nizyaeva NV, Kulikova GV, Nagovitsyna MN, Kan NE, Prozorovskaya KN, Shchegolev AI. Bull Exp Biol Med. 2018 Oct;165(6):793-797.

  • Overexpression of miR-519d in lung adenocarcinoma inhibits cell proliferation and invasion via the association of eIF4H. Bai Y, Lu C, Zhang G, Hou Y, Guo Y, Zhou H, Ma X, Zhao G. Tumour Biol. 2017 Mar;39(3):1010428317694566.

  • MiR-519a functions as a tumor suppressor in glioma by targeting the oncogenic STAT3 pathway. Hong L, Ya-Wei L, Hai W, Qiang Z, Jun-Jie L, Huang A, Song-Tao Q, Yun-Tao L. J Neurooncol. 2016 May;128(1):35-45.

  • MicroRNA-519a promotes tumor growth by targeting PTEN/PI3K/AKT signaling in hepatocellular carcinoma. Tu K, Liu Z, Yao B, Han S, Yang W. Int J Oncol. 2016 Mar;48(3):965-74.

  • Selective microRNA-Offset RNA expression in human embryonic stem cells. Asikainen S, Heikkinen L, Juhila J, Holm F, Weltner J, Trokovic R, Mikkola M, Toivonen S, Balboa D, Lampela R, Icay K, Tuuri T, Otonkoski T, Wong G, Hovatta O. PLoS One. 2015 Mar 30;10(3):e0116668.

  • MicroRNA-519a is a novel oncomir conferring tamoxifen resistance by targeting a network of tumour-suppressor genes in ER+ breast cancer. Ward A, Shukla K, Balwierz A, Soons Z, König R, Sahin O, Wiemann S. J Pathol. 2014 Aug;233(4):368-79.

  • MicroRNA-519a demonstrates significant tumour suppressive activity in laryngeal squamous cells by targeting anti-carcinoma HuR gene. Shen Z, Zhan G, Deng H, Ren Y, Ye D, Xiao B, Guo J. J Laryngol Otol. 2013 Dec;127(12):1194-202.

  • Deregulation of miR-519a, 153, and 485-5p and its clinicopathological relevance in ovarian epithelial tumours. Kim TH, Kim YK, Kwon Y, Heo JH, Kang H, Kim G, An HJ. Histopathology. 2010 Nov;57(5):734-43.

  • miRBase: integrating microRNA annotation and deep-sequencing data. Kozomara A, Griffiths-Jones S. Nucleic Acids Res. 2011 Jan;39(Database issue):D152-7.

  • The two stem cell microRNA gene clusters C19MC and miR-371-3 are activated by specific chromosomal rearrangements in a subgroup of thyroid adenomas. Rippe V, Dittberner L, Lorenz VN, Drieschner N, Nimzyk R, Sendt W, Junker K, Belge G, Bullerdiek J. PLoS One. 2010 Mar 3;5(3):e9485.

  • miR-519 reduces cell proliferation by lowering RNA-binding protein HuR levels. Abdelmohsen K, Srikantan S, Kuwano Y, Gorospe M. Proc Natl Acad Sci U S A. 2008 Dec 23;105(51):20297-302.

  • A mammalian microRNA expression atlas based on small RNA library sequencing. Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foà R, Schliwka J, Fuchs U, Novosel A, Müller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Weir DB, Choksi R, De Vita G, Frezzetti D, Trompeter HI, Hornung V, Teng G, Hartmann G, Palkovits M, Di Lauro R, Wernet P, Macino G, Rogler CE, Nagle JW, Ju J, Papavasiliou FN, Benzing T, Lichter P, Tam W, Brownstein MJ, Bosio A, Borkhardt A, Russo JJ, Sander C, Zavolan M, Tuschl T. Cell. 2007 Jun 29;129(7):1401-14.

  • miRBase: microRNA sequences, targets and gene nomenclature. Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A, Enright AJ. Nucleic Acids Res. 2006 Jan 1;34(Database issue):D140-4.

  • Identification of hundreds of conserved and nonconserved human microRNAs. Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z. Nat Genet. 2005 Jul;37(7):766-70.