Mature miRNA: hsa-miR-503-5p

Mature miRNA

miRNA Name hsa-miR-503-5p
Previous Name hsa-miR-503
miRNA Sequence 5' - uagcagcgggaacaguucugcag - 3' (length = 23)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0002874

Precursor miRNA

Precursor Name hsa-mir-503
Genomic Location chrX:134546328-134546398 (-); nearby genomic features
Clustered miRNAs hsa-mir-450b,hsa-mir-450a-1,hsa-mir-450a-2,hsa-mir-542,hsa-mir-503,hsa-mir-424 (within 10kb in genome)
NCBI GENE ID 574506
MIM ID 300865
miRBase ID MI0003188
Precursor Sequence 
      a              u  g  gu     a
ugcccu gcagcgggaacagu cu ca  gagcg u
|||||| |||||||||||||| || ||  |||||  c
auggga cgucgccuuuguua gg gu  cucgu g
      c              u  g  --     g

References

  • MicroRNA-503 Suppresses Oral Mucosal Fibroblast Differentiation by Regulating RAS/RAF/MEK/ERK Signaling Pathway. Wen D, Zhang H, Zhou Y, Jian N, Jiang C, Wang J. Biomolecules. 2024 Oct 5;14(10):1259.

  • LncRNA CYTOR knockdown inhibits tumor development via regulating miR-503-5p/PCSK9 in lung adenocarcinoma. Zhu Z, Lu J, Tong J, Yin Y, Zhang K. Am J Med Sci. 2024 Oct;368(4):382-391.

  • Downregulation of miR-503-5p Promotes the Development of Pancreatic Cancer by Targeting Cyclin E2. Li F, Ling YP, Wang P, Gu SS, Jiang H, Zhu J. Crit Rev Immunol. 2024;44(4):51-60.

  • Crucial role of hsa-mir-503, hsa-mir-1247, and their validation in prostate cancer. Hu P, Wang T, Yan H, Huang Y, Zhao Y, Gao Y. Aging (Albany NY). 2023 Nov 16;15(22):12966-12981.

  • β-Cell miRNA-503-5p Induced by Hypomethylation and Inflammation Promotes Insulin Resistance and β-Cell Decompensation. Zhou Y, Liu K, Tang W, Zhang Y, Sun Y, Wu Y, Shi Y, Yao Z, Li Y, Bai R, Liang R, Sun P, Chang X, Wang S, Zhu Y, Han X. Diabetes. 2024 Jan 1;73(1):57-74.

  • Hsa-miR-503-5p regulates CTDSPL to accelerate cisplatin resistance and angiogenesis of lung adenocarcinoma cells. Han J, Wang Y. Chem Biol Drug Des. 2023 Oct;102(4):749-762.

  • Experimental study of miR-503 regulating the activity as well as the function of degenerated human nucleus pulposus cells of the intervertebral disc through inhibiting Wnt pathway. Shi X, Tian S, Tian Y. J Musculoskelet Neuronal Interact. 2023 Mar 1;23(1):131-144.

  • Tumor Suppressor miRNA-503 Inhibits Cell Invasion in Head and Neck Cancer through the Wnt Signaling Pathway via the WNT3A/MMP Molecular Axis. Tang SJ, Fan KH, You GR, Huang SF, Kang CJ, Huang YF, Huang YC, Chang JT, Cheng AJ. Int J Mol Sci. 2022 Dec 14;23(24):15900.

  • Mesenchymal stem cells shuttling miR-503 Wang XS, Yu XJ, Wei K, Wang SX, Liu QK, Wang YG, Li H, Huang C. Oncoimmunology. 2021 Dec 30;11(1):1965317.

  • Ultrasound microbubble-mediated miR-503-5p downregulation suppressed in vitro CRC progression via promoting SALL1 expression. Wang Y, Li Y, Li X. Tissue Cell. 2022 Jun;76:101811.

  • Human umbilical cord blood mesenchymal stem cells-derived exosomal microRNA-503-3p inhibits progression of human endometrial cancer cells through downregulating MEST. Pan Y, Wang X, Li Y, Yan P, Zhang H. Cancer Gene Ther. 2022 Aug;29(8-9):1130-1139.

  • CircDLGAP4 overexpression relieves oxygen-glucose deprivation-induced neuronal injury by elevating NEGR1 through sponging miR-503-3p. Qiu L, He J, Chen H, Xu X, Tao Y. J Mol Histol. 2022 Apr;53(2):321-332.

  • LncRNA DLGAP1-AS2 regulates miR-503/cyclin D1 to promote cell proliferation in non-small cell lung cancer. Wang L, Tang L, Ge T, Zhu F, Liu D, Guo H, Qian P, Xu N. BMC Pulm Med. 2021 Aug 28;21(1):277.

  • LncRNA PART1 alleviated myocardial ischemia/reperfusion injury via suppressing miR-503-5p/BIRC5 mediated mitochondrial apoptosis. Guo Z, Zhao M, Jia G, Ma R, Li M. Int J Cardiol. 2021 Sep 1;338:176-184.

  • HDAC2 enhances esophageal squamous cell carcinoma development through down-regulating microRNA-503-5p and promoting CXCL10. Li J, Jin C, Sun L, Wang B, Hua P, Zhang Y. Clin Epigenetics. 2021 Apr 29;13(1):96.

  • Extracellular-vesicle containing miRNA-503-5p released by macrophages contributes to atherosclerosis. Wang Y, Xu Z, Wang X, Zheng J, Peng L, Zhou Y, Song Y, Lu Z. Aging (Albany NY). 2021 Apr 19;13(8):12239-12257.

  • Circ_0003266 sponges miR-503-5p to suppress colorectal cancer progression via regulating PDCD4 expression. Wen C, Feng X, Yuan H, Gong Y, Wang G. BMC Cancer. 2021 Mar 16;21(1):284.

  • circNRIP1 facilitates keloid progression via FXR1‑mediated upregulation of miR‑503‑3p and miR‑503‑5p. Wang B, Yin H, Zhang H, Wang T. Int J Mol Med. 2021 May;47(5):70.

  • ELK1-induced upregulation lncRNA LINC02381 accelerates the osteosarcoma tumorigenesis through targeting CDCA4 via sponging miR-503-5p. Bian X, Sun YM, Wang LM, Shang YL. Biochem Biophys Res Commun. 2021 Apr 9;548:112-119.

  • Silencing of long non‑coding RNA NEAT1 inhibits hepatocellular carcinoma progression by downregulating SMO by sponging microRNA‑503. Sun C, Xiao T, Xiao Y, Li Y. Mol Med Rep. 2021 Mar;23(3):168.

    • There are 110 references associated with hsa-miR-503-5p. Click here to see the complete list in PubMed.