Mature miRNA: hsa-miR-452-5p

Mature miRNA

miRNA Name hsa-miR-452-5p
Previous Name hsa-miR-452
miRNA Sequence 5' - aacuguuugcagaggaaacuga - 3' (length = 22)
Predicted Targets miRDB
Validated Targets TarBase
miRBase ID MIMAT0001635
Similar miRNAs hsa-miR-4676-3p, hsa-miR-892c-3p (sharing the same seed sequence with hsa-miR-452-5p).

Precursor miRNA

Precursor Name hsa-mir-452
Genomic Location chrX:151959628-151959712 (-); nearby genomic features
Clustered miRNAs hsa-mir-224,hsa-mir-452 (within 10kb in genome)
NCBI GENE ID 574412
miRBase ID MI0001733
Precursor Sequence 
  u          aac g        g  a        uuug
gc aagcacuuac   u uuugcaga ga acugagac    u
|| ||||||||||   | |||||||| || ||||||||     a
cg uucgugaaug   a aaacgucu cu ugacucug    a
  u          --a g        a  c        uauc

References

  • MiRNAs from the Dlk1-Dio3 locus and miR-224/452 cluster contribute to glioblastoma tumor heterogeneity. Smith CM, Catchpoole D, Hutvagner G. Sci Rep. 2024 Apr 13;14(1):8570.

  • MicroRNA 452 regulates SHC1 expression in human colorectal cancer and colitis. Mo JS, Lamichhane S, Yun KJ, Chae SC. Genes Genomics. 2023 Oct;45(10):1295-1304.

  • NF-κB Signaling Modulates miR-452-5p and miR-335-5p Expression to Functionally Decrease Epithelial Ovarian Cancer Progression in Tumor-Initiating Cells. Kamdar RD, Harrington BS, Attar E, Korrapati S, Shetty J, Zhao Y, Tran B, Wong N, House CD, Annunziata CM. Int J Mol Sci. 2023 Apr 25;24(9):7826.

  • MicroRNA-452: a double-edged sword in multiple human cancers. Karimi Dermani F, Datta I, Gholamzadeh Khoei S. Clin Transl Oncol. 2023 May;25(5):1189-1206.

  • LINC01140 Regulates Radiosensitivity of Nasopharyngeal Carcinoma Cells Through the ceRNA Network. Li J, Li Y, Liu L, Wu D, Yang T, Fan Y. Cell Mol Biol (Noisy-le-grand). 2022 Apr 30;68(4):75-85.

  • Integrative Analysis of Exosomal miR-452 and miR-4713 Downregulating Feng X, Ding Y, Zhou M, Song N, Ding Y. Dis Markers. 2022 Mar 30;2022:2843353.

  • CircZNF652 promotes the goblet cell metaplasia by targeting the miR-452-5p/JAK2 signaling pathway in allergic airway epithelia. Wang X, Xu C, Cai Y, Zou X, Chao Y, Yan Z, Zou C, Wu X, Tang L. J Allergy Clin Immunol. 2022 Jul;150(1):192-203.

  • MicroRNA 452 regulates Su Mo J, Cheon Chae S. J Genet. 2021;100:62.

  • MicroRNA 452 regulates IL20RA-mediated JAK1/STAT3 pathway in inflammatory colitis and colorectal cancer. Lamichhane S, Mo JS, Sharma G, Choi TY, Chae SC. Inflamm Res. 2021 Aug;70(8):903-914.

  • [Targeted binding of rs1053005 locus of STAT3 with miR-452-3p and the association between STAT3 gene polymorphism and noise-induced hearing loss]. Gao DF, Wang BS, Sun DW, Wang N, Guo JD, Zhu BL. Zhonghua Lao Dong Wei Sheng Zhi Ye Bing Za Zhi. 2021 Jun 20;39(6):412-417.

  • MicroRNAs miR-18a and miR-452 regulate the replication of enterovirus 71 by targeting the gene encoding VP3. Yang Z, Zhuo Q, Qin W, Wang J, Wang L, Tien P. Virus Genes. 2021 Aug;57(4):318-326.

  • MiR-452-5p promotes colorectal cancer progression by regulating an ERK/MAPK positive feedback loop. Lin X, Han L, Gu C, Lai Y, Lai Q, Li Q, He C, Meng Y, Pan L, Liu S, Li A. Aging (Albany NY). 2021 Mar 3;13(5):7608-7626.

  • MicroRNA 452 regulates ASB8, NOL8, and CDR2 expression in colorectal cancer cells. Mo JS, Chae SC. Genes Genomics. 2021 Jan;43(1):33-41.

  • Discovery and validation of miR-452 as an effective biomarker for acute kidney injury in sepsis. Liu Z, Yang D, Gao J, Xiang X, Hu X, Li S, Wu W, Cai J, Tang C, Zhang D, Dong Z. Theranostics. 2020 Oct 25;10(26):11963-11975.

  • CircKIAA0907 Retards Cell Growth, Cell Cycle, and Autophagy of Gastric Cancer In Vitro and Inhibits Tumorigenesis In Vivo via the miR-452-5p/KAT6B Axis. Zhu L, Wang C, Lin S, Zong L. Med Sci Monit. 2020 Jul 28;26:e924160.

  • Long Noncoding RNA SOX2-OT Knockdown Inhibits Proliferation and Metastasis of Prostate Cancer Cells Through Modulating the miR-452-5p/HMGB3 Axis and Inactivating Wnt/β-Catenin Pathway. Song X, Wang H, Wu J, Sun Y. Cancer Biother Radiopharm. 2020 Nov;35(9):682-695.

  • Circular RNA-ABCB10 suppresses hepatocellular carcinoma progression through upregulating NRP1/ABL2 via sponging miR-340-5p/miR-452-5p. Yang W, Ju HY, Tian XF. Eur Rev Med Pharmacol Sci. 2020 Mar;24(5):2347-2357.

  • miR-452 promotes the development of gastric cancer via targeting EPB41L3. He X, Shu Y. Pathol Res Pract. 2020 Jan;216(1):152725.

  • Intermittent Hypoxia Up-Regulates Uchiyama T, Itaya-Hironaka A, Yamauchi A, Makino M, Sakuramoto-Tsuchida S, Shobatake R, Ota H, Takeda M, Ohbayashi C, Takasawa S. Int J Mol Sci. 2019 Apr 22;20(8):1960.

  • Sunitinib-suppressed miR-452-5p facilitates renal cancer cell invasion and metastasis through modulating SMAD4/SMAD7 signals. Zhai W, Li S, Zhang J, Chen Y, Ma J, Kong W, Gong D, Zheng J, Xue W, Xu Y. Mol Cancer. 2018 Nov 12;17(1):157.

    • There are 47 references associated with hsa-miR-452-5p. Click here to see the complete list in PubMed.